CAMPBELL BIOLOGY IN FOCUS-MOD.MASTERING
3rd Edition
ISBN: 9780135191811
Author: Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 18.2, Problem 3CC
Summary Introduction
To describe:
The role of non-coding RNAs that are not transcribed into mRNA.
Introduction:
The National Human Genome Research Institute launched a public research association named ENCODE, the Encyclopedia of DNA Elements, in September 2003. It is a project to identify all the functional elements in human genome sequence.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Q1 There are similarities and differences during regulation of gene expression in both prokaryotes and eukaryotes. Promoters, transcription factors and RNA polymerase are essential elements in transcription but their properties and function may differ.
b) Hypothesize the transcription of eukaryotic genes using prokaryotic promoter with further explanation.
WHAT IF? What would be the effect of treating cellswith an agent that removed the cap from mRNAs?
WHAT IF? DRAW IT The template strand of a geneincludes this sequence:3¿-TACTTGTCCGATATC-5¿. It is mutated to3¿-TACTTGTCCAATATC-5¿. For both wild-type and mutantsequences, draw the double-stranded DNA, the resultingmRNA, and the amino acid sequence each encodes. Whatis the effect of the mutation on the amino acid sequence?
Chapter 18 Solutions
CAMPBELL BIOLOGY IN FOCUS-MOD.MASTERING
Ch. 18.1 - Prob. 1CCCh. 18.2 - Prob. 1CCCh. 18.2 - Explain the advantage of the systems biology...Ch. 18.2 - Prob. 3CCCh. 18.3 - The best estimate is that the human genome...Ch. 18.3 - Prob. 2CCCh. 18.3 - Prob. 3CCCh. 18.4 - Discuss the characteristics of mammalian genomes...Ch. 18.4 - Which of the three mechanisms described in Figures...Ch. 18.4 - Prob. 3CC
Ch. 18.5 - Describe three examples of errors in cellular...Ch. 18.5 - Prob. 2CCCh. 18.5 - Prob. 3CCCh. 18.6 - Would you expect the genome of the macaque (a...Ch. 18.6 - Prob. 2CCCh. 18 - Prob. 1TYUCh. 18 - Prob. 2TYUCh. 18 - Two eukaryotic proteins have one domain in common...Ch. 18 - DRAW IT Comparing amino acid sequences of similar...Ch. 18 - SCIENTIFIC INQUIRY The scientists mapping human...Ch. 18 - FOCUS ON EVOLUTION Genes important in the...Ch. 18 - FOCUS ON INFORMATION The continuity of life is...Ch. 18 - SYNTHESIZE YOUR KNOWLEDGE Insects have three...
Knowledge Booster
Similar questions
- HELP PLEASE !! In moelcular genetics, initiation is often accomplished using proteins that prevent elongation. Name and describe 3 processes where this happens, they can be in different species. Make sure to name or describe the proteins and substrates involved and how the elongation inhibition is overcome.arrow_forwardQ15. Some viruses that infect E. coli produce an “anti-terminator” protein that causes RNA polymerase to “ignore” the termination signal of one virus gene and continue transcribing right into the next gene. What might this anti-terminator protein do? A. Bind to DNA, causing a loop that prevents the RNA polymerase from reaching the termination signal in DNA. B. Bind to mRNA to prevent it from complementary base pairing with itself at the terminator signal. C. Bind to the termination factor, keeping it away from ribosomes that reach the stop codon. D. Bind to the polyadenylation signal, preventing the action of the RNAase clipping enzyme.arrow_forwardPlease answer fast Explain how you would go about developing new ribozymes capable of targeting new sequences and that can be controlled using effector molecules of your choosing.arrow_forward
- MAKE CONNECTIONS Compare the CRISPR-Cas systemto the miRNA system discussed in Concept 18.3, includingtheir mechanisms and their functions.arrow_forward5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’sarrow_forwardWHAT IF? In eukaryotic cells, mRNAs have been foundto have a circular arrangement in which proteins holdthe poly-A tail near the 5¿ cap. How might this increasetranslation efficiency?arrow_forward
- Q10. Does frame +2 have an ORF in the coding region of this exon? What about frame +1 and frame +3? Q11. Given that 3 of the 64 possible codons are stop codons, what is the chance of having a stop codon at any given position, assuming that the sequence is random?arrow_forwardExploring Further: The table below outlines the stpes in eukaryotic gene expressions. Briefly summarize each steps given. Gene Expression Steps Molecules Involved Summary What molecules and proteins are What happens during this involved in this steps? step? Transcription RNA Splicing MRNA Transport Translation Protein Processingarrow_forwardTask #2: Examine the gene, transcript and polypeptide sequences Next, it's important to understand how the gene would be transcribed and translated. A 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61 tcggcggccc tggccctgac cgagacctgg gccggtgagt gcgggtcggg agggaaatgg 121 cctctgccgg gaggagcgag gggaccgcag gcgggggcgc atgacctcag gagccgcgcc 181 gggaggaggg tcgggcgggt ctcagcccct cctcaccccc aggctcccac tccatgtggt 241 atttctacac ctccgtgtcc cggcccqgcc gcggggagcc ccgcttcatc tcagtgggct 301 acgtggacga cacccagttc gtgaggttcg acagcgacgc cgcgagtccg agagaggagc 361 cgcgggcgcc gtggatagag caggaggggc cggagtattg ggaccggaac acacagatct 421 acaaggccca ggcacagact gaccgagaga gcctgcggaa cctgcgcttc tactacaacc 481 agagcgaggc cgttgcgtga ccccggcccg gggcgcaggt cacgactccc catcccccac 541 gtacggcccg ggtcgccccg agtctccggg tccgagatcc gcctccctga ggccgcggga a) coding region i) What is the length of the coding region (in nucleotides)? ii) Explain how you arrived at your answer for (i). iii) Which nucleotides…arrow_forward
- Suppose your supervisor is working on a molecule “X” with UniProtKB accession number P18564. Being a team member in the project, you have been asked to provide the following information with high accuracy? I. Chromosome number: II. Protein size: III. Number of exons: IV. Stop codon: V. Size of the longest exon in nucleotidesarrow_forwardQ5. A sh mutant called shXS is isolated that produces a truncated polypeptide of only 6 AAs in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.) [10%] Q6. A single basepair mutant in the sh gene (shNH) was found to have an A mutated into a G at the 3rd position of the 3rd codon of the sh gene: WILD-TYPE: 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ Mutant shNH 5’-tataatgggcttaacaATGAGTAAGAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ What are the functional consequences of this mutation for the Sh protein? Motivate your answer (100 words max.) [10%]arrow_forwardSelect all the examples of mutations that are likely to have a global effect on gene expression. e to search * W Check All That Apply # 3 E a mutation in a splice donor recognition sequence within an snRNA gene a hypomorphic mutation in the catalytic site of RNA polymerase a silent mutation in a gene encoding a protein in the small ribosomal subunit 14 $ IDI 4 O R f5 % i 5 ved partial credit in the previous attempt. T ^ ?b f10 83°F Mc O f1arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning