EBK CAMPBELL BIOLOGY
10th Edition
ISBN: 9780136539414
Author: Reece
Publisher: VST
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 18.3, Problem 2CC
WH AT IF? Ø Suppose the mRNA being degraded in Figure 18.14 coded for a protein that promotes cell division in a multicellular organism. What would happen if a muta- tion disabled the gene for the miRNA that triggers this degradation?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What are the differences between miRNA and siRNA?
(Select all that apply.)
OmiRNAs carry the genetic information from the DNA in
the nucleus directly to the cytoplasm, and siRNAs are
involved in the degradation of specific mRNA molecules.
miRNAs are from 22 to 30 bases long, and siRNAs are 22
bases long.
O miRNAs carry the genetic information from the DNA in
the nucleus directly to the cytoplasm, and siRNAs help
with the processing of the initial mRNA transcribed from
DNA into a mature form.
miRNAs prevent translation of certain mRNAs, and
siRNAs are involved in the degradation of specific mRNA
molecules.
miRNAs are 20 to 22 bases long, and siRNAs are from 20
to 30 bases long.
Suppose multiple mutations occur in the U1 snRNA. Which step in the mRNA Spllcing
mechanism would be directly impaired?
The second transesterification reaction
5' splice site/donor site recognition
3' splice site/acceptor site recognition
O Branch site recognition
. Eukaryotic processing of hnRNA into mature mRNA includes all of the following steps except:
ribosome attachment of methionine to the 5’-AUG-3’ codon
5’-addition of a 7-methylguanosine cap
3’-addition of a polyadenylated tail
splicing together of exons
excision of introns
Chapter 18 Solutions
EBK CAMPBELL BIOLOGY
Ch. 18.1 - How does binding of the trp corepressor to the trp...Ch. 18.1 - Describe the binding of RNA Polymerase,...Ch. 18.1 - WHAT IF? A certain mutation in E. coli changes...Ch. 18.2 - In general, what are the effects of histone...Ch. 18.2 - Compare the roles of general and specific...Ch. 18.2 - WHAT IF? Suppose you compared the nucleotide...Ch. 18.2 - Once mRNA encoding a particular protein reaches...Ch. 18.3 - Compare miRNAs and siRNAs, including their...Ch. 18.3 - WH AT IF? Suppose the mRNA being degraded in...Ch. 18.4 - MAKE CONNECTIONS As you learned in Chapter 12,...
Ch. 18.4 - MAKE CONNECTIONS Explain how the signaling...Ch. 18.4 - How do fruit fly maternal effect genes determine...Ch. 18.4 - Prob. 4CCCh. 18.5 - MAKE CONNECTIONS The p53 protein can activate...Ch. 18.5 - Under what circumstances is cancer considered to...Ch. 18.5 - Prob. 3CCCh. 18 - Compare and contrast the roles of a corepressor...Ch. 18 - Describe what must happen in a cell for a gene...Ch. 18 - Why are miRNAs called noncoding RNAs? Explsin how...Ch. 18 - Describe the two main processes that cause...Ch. 18 - Compare the usual functions of proteins encoded by...Ch. 18 - If a particular operon encodes enzymes for making...Ch. 18 - Muscle cells differ from nerve cells mainly...Ch. 18 - The functioning of enhancers is an example of (A)...Ch. 18 - Cell differentiation always involves (A)...Ch. 18 - Which of the following is an example of...Ch. 18 - What would occur if the repressor of an inducible...Ch. 18 - Absence of bicoid in mRNA from a Drosophila egg...Ch. 18 - Which of the following statements about the DNA in...Ch. 18 - Within a cell, the amount of protein made using a...Ch. 18 - Prob. 10TYUCh. 18 - Prob. 11TYUCh. 18 - Prob. 12TYUCh. 18 - Prob. 13TYUCh. 18 - Prob. 14TYUCh. 18 - WRITE ABOUT A THEME: INTERACTIONS In a Short essay...Ch. 18 - SYNTHESIZE YOUR KNOWLEDGE The flashlight fish has...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Some people consider Pasteur or Koch to be the Father of Microbiology, rather than Leeuwenhoek. Why might they ...
Microbiology with Diseases by Body System (4th Edition)
1. Genetics affects many aspects of our lives. Identify three ways genetics affects your life or the life of a ...
Genetic Analysis: An Integrated Approach (2nd Edition)
Propose a model for the assembly of a flagellum in a typical Gram-positive cell envelope.
Prescott's Microbiology
Some people consider Pasteur or Koch to be the Father of Microbiology, rather than Leeuwenhoek. Why might they ...
Microbiology with Diseases by Body System (5th Edition)
Sea turtles have disappeared from many regions, and one way of trying to save them is to reintroduce them to ar...
Marine Biology (Botany, Zoology, Ecology and Evolution)
Relative thickness of the myocardium in different chambers; the functional significance of those differences; a...
Anatomy & Physiology: The Unity of Form and Function
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- mRNA: 5’ – UGAUCAUGAUCUCGUAAGAUAUC – 3’ -Draw a box around the sequence where protein synthesis will begin. What is this sequence called? Does an amino acid get inserted at this site? If so, which one? -Draw in an arrow to show the direction that a ribosome will move along the mRNA strand. -From the starting point, mark off the codons, and identify the correct amino acid that will be inserted at that codon. -Draw a second box around the sequence where protein synthesis will stop. What is this sequence called? -Label the N-terminus and C-terminus of the polypeptide (amino acid) chain.arrow_forwardList and briefly explain. C-terminal domain of RNA polymerase II function to ensure that the varoius sets of mRNA processing enzymes carry out their duties at the apporpiate time and place?arrow_forwardSARS E You have generated several random mutations in this region. One of them is - 5'-AAUUACCUAUAGAUUGUUU-3' What may be the mutant protein sequence Enter the single letter code for the amino acids. For a stop codon (if any) enter: STOP And fill subsequent blanks with: N/A For example: if you the sequence you need to enter is: M*, enter M N/A N/A N/A N/Aarrow_forward
- Explain how the miR-200 family of miRNAs behave as tumorsuppressorgenes. What happens when their expression is blocked or decreased?arrow_forwardSA p PDF as trasc d PDF During the translation of an mRNA segment, different activated tRNAs (aatRNAs)-specified here by their anticodons written 3' to 5' bind through hydrogen bonds to mRNA in subscripts-successively codons in the following order: Teas fill PDF Cave UNOFFIC aatRNAGAA binds, then aatRNACAC, then aatRNAUUG, then aatRNAGUU, then aatRNAGUG, then aatRNAGAC What would the sequence of that mRNA segment be? O GAA CAC UUG GUU GUG GAC O CUU GUG AAC CAA CAC CUG O CTT GTG AAC CAA CAC CTG O Glu-His-Leu-Val-Val-Asp hu O Search PD maste omissarrow_forwardmiRNAs target endogenous mRNAs in a sequence-specific manner. Explain, conceptually, how one might identify potential mRNA targets for a given miRNA if you only know the sequence of the miRNA and the sequence of all mRNAs in a cell or tissue of interest.arrow_forward
- The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.arrow_forwardDuring periods of starvation, translation of only vital mRNAs must occur inside a cell. Explain how eIF2 can mediate both the suppression of translation of non-essential mRNAs and ensure that essential mRNAs continues to be translated.arrow_forwardConsider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping. How many codons are represented in this oligonucleotide? If the second G were changed to a C, what would be the resulting amino acid?arrow_forward
- -If the first G get deleted what kind of mutation will happen? Show the change in amino acid sequence. deletion lead to change in reading frame (triplet grouping) of the mRNA, so that nucleotides are grouped into different codons, lead to significant changes in amino acid sequence downstream of the mutation. TACCTA-CACACATGTAGGTGGGCAAAGTT -Multiple mechanisms regulate gene expression in eukaryotes. What are the mechanisms that control the gene expression in nucleus and what are the mechanisms that control the gene expression in cytoplasm. (names not definitions)arrow_forwardPPPP 2.7 essage hatentaded pruteiis? gene iS shown below (starting with ATG), What is the resulting mRNA? From which strand was this MRNA generated? 5'-ATGCCATTCGAA-3' 3'-TACGGTAAGCTT-5' 21. What is meant by degenerate but not ambiguous?arrow_forwardGiven the following genomic sequence which contains 2 exons and CDNA sequence predidt the amino acid sequence of the exons which are part of the coding region of a protein. How many nucleotides make up the intron? Second letter UAU TV UACJ UAA Stop|UGA Stop A UAG Stop UG Trp UUU1 Phe UUCJ UGU1, UGCJ UCU) Cys UCC Ser UCA ULA UCG CUUT CUC CUA CUG CCU CAUT C4C His CAAT CAGJ OGU CCC Leu CA CGC FArg CGA Gln CGG Pro CCG AUU AUC lle AUA ACU AGU AAU AACJ AAA 1 AAGYS Asn Ser ACC Thr ACA AGC. AGA Arg AUG Mer ACG, AGG GCU GAUT GACJ GGU GGC GUU Asp GUC Val GUA Gly Ala GAA Glu GAGJ GGA GGG GUG GCG G. Genomic antisense sequence: 5'-TAACTGATTCTAGGCTACTCTTTCACCTAA-3" CDNA sequence: 5'-TAACTGATTTCTTTCACCTAA-3" I Use the editor to format your answer First letter 皇 Third letterarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY