PPPP 2.7 essage hatentaded pruteiis? gene iS shown below (starting with ATG), What is the resulting mRNA? From which strand was this MRNA generated? 5'-ATGCCATTCGAA-3' 3'-TACGGTAAGCTT-5' 21. What is meant by degenerate but not ambiguous?

PPPP 2.7 essage hatentaded pruteiis? gene iS shown below (starting with ATG), What is the resulting mRNA? From which strand was this MRNA generated? 5'-ATGCCATTCGAA-3' 3'-TACGGTAAGCTT-5' 21. What is meant by degenerate but not ambiguous?

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 15RQ: A scientist identifies a pre-mRNA with the following structure. What is the predicted size of the...

See similar textbooks

Related questions

Q: 30 A DNA sequence encoding a five-amino acid polypeptide is given below.…

A: The genetic code is which allows DNA and RNA sequences to be decoded into the amino acids of a…

Q: A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that…

A: The normal mRNA is 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ The bases in bold form the start codon.…

Q: 2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation…

A: DNA(deoxyribonucleic acid) is the genetic material in all the organisms except few viruses. The…

Q: 1 of 22 Suppose the DNA of a gene contains seven regions, A through G, in that order. Regions A, B,…

A: Given: The regions A,B,F are present in Exons The region C,D,E,G are present in Introns. Find the…

Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. What…

A: The process of formation of mRNA from template DNA sequence is known as transcription. The process…

Q: Given this MRNA strand: 3 - AUGAGGAAGGUA - 5"; what are the components of the polypeptide?

A: The polypeptide is formed by decoding the triplet codons using the codon table given. The mRNA…

Q: 16) PROTEIN SYNTHESIS: A) Describe the process of protein synthesis. Be sure to use transcription…

A: Proteins are polymers of amino acids formed via peptide bond between two amino acids .

Q: Given this mRNA strand: 3’ - AUGAGGAAGGUA - 5’; what are the components of the polypeptide?

A: Translation is the process in which the genetic message carried by mRNA from the DNA is converted in…

Q: 10. (a) What are exon and intron? Explain the process of RNA splicing to highlight that different…

A: Given: RNA splicing is a molecular biological process in which newly synthesised MRNA transcribed…

Q: 16)(comprehension) Suppose the following DNA sequence was mutated from 3'-AGAGAGAGAGAGAGAGAG-5' to…

A: The central dogma states that DNA undergoes transcription to form mRNA which then gets translated to…

Q: 20. in differential translation, a different transcript may be recovered depending on which TATA box…

A: Translation: The process through which RNA codes for specific proteins is known as translation. It…

Q: 24. Use the table below to answer the following question. The template strand of a gene contains…

A: The DNA molecules are double stranded in structure . The DNA structure undergoes the process of…

Q: 29) Which one of the following statements about RNA processing is correct? A) Exons are cut out…

A: The term DNA stands for deoxyribonucleic acid. Deoxyribonucleic acid is the most important…

Q: Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and…

A: The synthesis of m RNA from DNA is called transcription.

Q: mRNA: 5’ – UGAUCAUGAUCUCGUAAGAUAUC – 3’ -Draw a box around the sequence where protein synthesis…

A: CENTRAL DOGMA:- The whole process of Central Dogma involves two processes:- 1) When DNA changes into…

Q: 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the…

A: Transcription is the process of formation of RNA from a DNA. The RNA chain is synthesized in the…

Q: 20 of 22 If a strand of MRNA has the sequence 5'-CUGUCA...ACUC-3' (with [….] representing the…

A: Transcription process takes place in the nucleus. It is responsible for producing mRNA from template…

Q: 3a) In a hypothetical cell where "wobble" pairing was not allowed (i.e. every codon must be matched…

A: Transfer RNA or tRNA is defined as a molecule which helps to decode mRNA or messenger RNA into a…

Q: 5’-AUGCCGGACUGAAAU-3’ What is the sequence of the resulting protein assuming the ribosome takes the…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: Consider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code…

A: DNA or deoxyribonucleic acid undergoes transcription and produces messenger RNA sequence in the form…

Q: 11) Which of the following characteristics is directly related to the coding of a single amino acid…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: 26. Using the following DNA strand, write out the mRNA, and then the amino acids. DNA: 3' T- A- C-…

A: Since we only answer one question at a time, we’ll answer question 27 (as you have already solved…

Q: 8. A peptide hormone consists of nine amino acids in this sequence: arg-pro-pro-gly-phe-…

A: In this question, we are given a peptide sequence which is arg-pro-pro-gly-phe-ser-pro-phe-arg. We…

Q: Mutated DNA Sequence #1 TACAT CTTGG C G A C G ACT... What's the mRNA sequence? (Circle the change)…

A: Mutations are changes that occurs in nucleotide sequence of DNA.The types of mutation are:…

Q: 4. A protein is found with the sequence Met-Thr-Tp-Phe-Lys-Cys-Arg-His-Pro-Gly, A mutant is found…

A: Mutations are change in the nucleotide sequence which results in abnormalities in the protein…

Q: c. On the mature mRNA transcript in eukaryotes, start codon is not found at the beginning of the 5'…

A: Mature mRNA transcripts in eukaryotes are those eukaryotic RNA transcripts that have been spliced…

Q: (hitic 6. Below, on the left, are the sequences of 3 pre-mRNAs. The exons are underlined and the…

A: Question - 6: Transcription: - The synthesis of mRNA from DNA is called Transcription. - It is a…

Q: Which mRNA modification is likely absent if the mRNA is degrading prematurely from the 5’ end of the…

Q: 21. The processing events that must occur on the MRNA after it is transcribed, but before it is…

A: In eukaryotes, transcription and translation take place in different cellular compartments:…

Q: 11. Why is RNA polymerase a good name for this enzyme? Explain each part of the name: RNA, polymer…

A: Replication is the process which makes DNA from the parental strand of DNA. Transcription is…

Q: 21. mRNA serves as template for the synthesis of polypeptide. true or false

A: The translation process is by which organisms forms protein or a polypeptide chain.

Q: 2. Given the mRNA for a protein: 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' Write the amino acid…

A: We'll answer the first question since the exact one is not specified. Please submit a new question…

Q: Sequential binding of RNA polymerase II-TFIIF complex, TFIIE, and TFIIH completes…

A: RNA Polymerase II is responsible for the transcription of messenger RNA with the help of DNA. For…

Q: 25. A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a…

A: The translation is a process of Protein synthesis where a copy of mRNA is used as a template strand.…

Q: pc*00ATAAADDATATAJOTTAA 1. Use the genetic code table and the information in the diagram below to…

A: Translation, in molecular biology and genetics, is the process by which ribosomes in the cytoplasm…

Q: Mutated DNA Sequence #4 ТАСАС СТTGG CGACT АСТ... What's the mRNA sequence? (Circle the change) amino…

A: DNA is two stranded structure which make it own strand via replication process . It comprises of…

Q: 5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle…

A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: Given the going with molecule of DNA: strand 1 – A T G C G C T A C G C A T–strand 2 – T A C G C G A…

A: In living organisms, the genetic instructions for growth, development, functioning, and reproduction…

Q: b. FALSE Unanswered a Save 58 What segments of the pre mRNA comprise the coding region? pre-mRNA 5'…

A: Introduction :- When an RNA transcript is first produced in a eukaryotic cell, it is referred to as…

Q: 1. In what direction does a polymerase move when synthesizing a strand of mRNA? Briefly Explain. 2.…

Q: 32.) Translate the following mRNA into protein primary structure. Use the ONE-LETTER abbreviations…

A: Note: You have asked multiple independent questions and thus we have solved the first question for…

Q: 37. A portion of an mRNA attached to a ribosome reads: 5′ UUUGACCCCACG 3′ If a tRNA with an…

A: answer The tRna with which amino acid attached will enter A site will be CCC codon which codes for…

Q: 19. Name and describe the three types of RNA involved in TRANSLATION: Ribosome - Amino acid - Uracil…

A: Translation is the process which leads to synthesize the protein. It takes place in the cytoplasm.

Q: 1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand:…

A: Transcription is the process of synthesis of mRNA by using a template DNA strand. Translation is the…

Q: 29. Here is a strand of DNA: TACCCGGTATAACGCTGGAAAGCTTAAGCAACATCGCCCGACCCC AAATCT…

A: DNA strand given here with directionality is as: 5’…

Q: 6. Given: 3--TACTTCAAACCGGGCCCGATT--5 a) Give the sequence of nucleotides in the mRNA. b) What is…

A: The DNA is translated into mRNA by transcription process and then the mRNA is translated into…

Q: 34. Arrange the following list of eukaryotic gene elements in the order in which they would appear…

A: Since we only answer one question at a time, we’ll answer the first one. Please resubmit the…

Q: GAC UAU GCG GGA GGO AAG CA UGA iwhat is The auino a cid that would Lesult from this m RNA SeepuenU?

A: Adenine in RNA binds with uracil (Thymine is replaced by uracil in RNA) and guanine with cytosine.…

Q: 12. The following codons and the amino acids they encode is as follows: AUG = Met %3D UUU, UUC = Phe…

A: ANSWER;- a) The sequence of amino acids in the following structure Met-Phe-Leu-Ser-Thr-Pro b)(i) DNA…

Question

PPPP
2.7
essage hatentaded pruteiis?
gene iS shown below (starting with ATG), What is the resulting mRNA? From which strand was this MRNA
generated?
5'-ATGCCATTCGAA-3'
3'-TACGGTAAGCTT-5'
21. What is meant by degenerate but not ambiguous?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Step 5

Trending now

This is a popular solution!

Step by step

Solved in 5 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
Consider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping. How many codons are represented in this oligonucleotide? If the second G were changed to a C, what would be the resulting amino acid?
25. A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? Group of answer choices 1. Asparagine 2. Lysine 3. Threonine 4. Glutamic Acid
4. A mini mRNA has the sequence 5’-UUUGAAAUAUGAUUGAUAUUUAUAUAUGA-3. a) Using the genetic code, provide the amino acids specified by the mini mRNA. b) Label the two ends of the short peptide.
26. differential lengths of poly-A tails affect mRNA stability identify which describes the statement above a. pre-transcriptional controlb. transcriptional controlc. translational controld. post-translational control v
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… b)Give the sequence and polarity of the mRNA encoding the polypeptide.
37. A portion of an mRNA attached to a ribosome reads: 5′ UUUGACCCCACG 3′ If a tRNA with an aspartic acid amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? What amino acid will be attached to the amino group of the histidine encoded by this mRNA?
46What is the A-site of the ribosome? A.exit siteb.aminoacyl-tRNA binding sitec.peptidyl-tRNA binding siteD.peptidyltransferase site 47This sequence motif, which is called the ( ) , is usually located 25 to 30 bp upstream from the transcription initiation site. 48Pre-mRNA requires specific sequences for precise __________ to occur. A.splicingb.taggingc.replicationD.skipping
A scientist identifies a pre-mRNA with the following structure. What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5' cap and 3’ poly-A tail? 220bp 295bp 140bp 435bp
An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bp
A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of elF-2 alter translation? Initiation factors would not be able to bind to mRNA The large ribosomal subunit would not be able to interact with itiRNA transcripts tRNAi-Met would not scan mRNA transcripts for the start codon elF-2 would not be able to interact with the small ribosomal subunit.
A scientist sequencing itiRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this itiRNA makes when it is translated?