CAMPBELL BIOLOGY V.1 W/MAST.BIOL >CI<
15th Edition
ISBN: 9781269867115
Author: Reece
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 18.3, Problem 2CC
WH AT IF? Ø Suppose the mRNA being degraded in Figure 18.14 coded for a protein that promotes cell division in a multicellular organism. What would happen if a muta- tion disabled the gene for the miRNA that triggers this degradation?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
a) Identify the current stage of the translation process shown in Figure 1 and name the anticodon sequence in tRNAb) State TWO immediate, main consequences when a stop codon reaches the E site.
Q.)
A.)Search in human genome if any examples of mRNA translated from 2 different sites?and give examples?
B.)aminoacyl tRNA synthetase is specialized or not ? And why?
5’ UGG CAA UCC UAC GAU 3’
Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the
mRNA.
2. Write out a possible miRNA that could regulate the expression of this gene
Chapter 18 Solutions
CAMPBELL BIOLOGY V.1 W/MAST.BIOL >CI<
Ch. 18.1 - How does binding of the trp corepressor to the trp...Ch. 18.1 - Describe the binding of RNA Polymerase,...Ch. 18.1 - WHAT IF? A certain mutation in E. coli changes...Ch. 18.2 - In general, what are the effects of histone...Ch. 18.2 - Compare the roles of general and specific...Ch. 18.2 - WHAT IF? Suppose you compared the nucleotide...Ch. 18.2 - Once mRNA encoding a particular protein reaches...Ch. 18.3 - Compare miRNAs and siRNAs, including their...Ch. 18.3 - WH AT IF? Suppose the mRNA being degraded in...Ch. 18.4 - MAKE CONNECTIONS As you learned in Chapter 12,...
Ch. 18.4 - MAKE CONNECTIONS Explain how the signaling...Ch. 18.4 - How do fruit fly maternal effect genes determine...Ch. 18.4 - Prob. 4CCCh. 18.5 - MAKE CONNECTIONS The p53 protein can activate...Ch. 18.5 - Under what circumstances is cancer considered to...Ch. 18.5 - Prob. 3CCCh. 18 - Compare and contrast the roles of a corepressor...Ch. 18 - Describe what must happen in a cell for a gene...Ch. 18 - Why are miRNAs called noncoding RNAs? Explsin how...Ch. 18 - Describe the two main processes that cause...Ch. 18 - Compare the usual functions of proteins encoded by...Ch. 18 - If a particular operon encodes enzymes for making...Ch. 18 - Muscle cells differ from nerve cells mainly...Ch. 18 - The functioning of enhancers is an example of (A)...Ch. 18 - Cell differentiation always involves (A)...Ch. 18 - Which of the following is an example of...Ch. 18 - What would occur if the repressor of an inducible...Ch. 18 - Absence of bicoid in mRNA from a Drosophila egg...Ch. 18 - Which of the following statements about the DNA in...Ch. 18 - Within a cell, the amount of protein made using a...Ch. 18 - Prob. 10TYUCh. 18 - Prob. 11TYUCh. 18 - Prob. 12TYUCh. 18 - Prob. 13TYUCh. 18 - Prob. 14TYUCh. 18 - WRITE ABOUT A THEME: INTERACTIONS In a Short essay...Ch. 18 - SYNTHESIZE YOUR KNOWLEDGE The flashlight fish has...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Some people consider Pasteur or Koch to be the Father of Microbiology, rather than Leeuwenhoek. Why might they ...
Microbiology with Diseases by Body System (4th Edition)
1. Genetics affects many aspects of our lives. Identify three ways genetics affects your life or the life of a ...
Genetic Analysis: An Integrated Approach (2nd Edition)
Propose a model for the assembly of a flagellum in a typical Gram-positive cell envelope.
Prescott's Microbiology
Some people consider Pasteur or Koch to be the Father of Microbiology, rather than Leeuwenhoek. Why might they ...
Microbiology with Diseases by Body System (5th Edition)
Sea turtles have disappeared from many regions, and one way of trying to save them is to reintroduce them to ar...
Marine Biology (Botany, Zoology, Ecology and Evolution)
Relative thickness of the myocardium in different chambers; the functional significance of those differences; a...
Anatomy & Physiology: The Unity of Form and Function
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- WHAT IF? Suppose the mRNA being degraded in Figure18.14 coded for a protein that promotes cell division ina multicellular organism. What would happen if a mutation disabled the gene for the miRNA that triggers thisdegradation?arrow_forwardA scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of elF-2 alter translation? Initiation factors would not be able to bind to mRNA The large ribosomal subunit would not be able to interact with itiRNA transcripts tRNAi-Met would not scan mRNA transcripts for the start codon elF-2 would not be able to interact with the small ribosomal subunit.arrow_forward0. Explain how differences in the initiation of translationdictate that eukaryotic mRNAs are monocistronicwhile prokaryotic mRNAs may be polycistronic.arrow_forward
- Which is the odd one out ? explain how the rest are related nucleoid cytoplasm RNA-binding protein tRNA mRNA rRNA miRNAarrow_forwardQ: Ligands are extracellular proteins involved in signalling. Explain how a typical ligand is secreted starting from the time the ribosome starts translating the mRNA of the gene encoding the ligand. ** THE ANSWER SHOULD NOT EXPLAIN THE MECHANISM OF TRANSLATION **arrow_forwardPlease answer fast Explain how you would go about developing new ribozymes capable of targeting new sequences and that can be controlled using effector molecules of your choosing.arrow_forward
- Yes or no? reverse genetics is RNA interference example. cellular differentiation potency in multipotent is greater than pluripotent stem cell. does digoxigenin UTO use to make dsrna and perform rna interference?arrow_forwardmRNA: 5’ – UGAUCAUGAUCUCGUAAGAUAUC – 3’ -Draw a box around the sequence where protein synthesis will begin. What is this sequence called? Does an amino acid get inserted at this site? If so, which one? -Draw in an arrow to show the direction that a ribosome will move along the mRNA strand. -From the starting point, mark off the codons, and identify the correct amino acid that will be inserted at that codon. -Draw a second box around the sequence where protein synthesis will stop. What is this sequence called? -Label the N-terminus and C-terminus of the polypeptide (amino acid) chain.arrow_forwardGive typing answer with explanation and conclusion to all parts Consider the following DNA mRNA sequence: 5’-ACTGATCCATGCCAGGGGTTTTCAACTAAAATGAAA-3’ a) What is the template sequence this mRNA was transcribed from? Include 5’ and 3’ labels. b) Based on this sequence, what you predict would be the resulting peptide sequence from it. c) In examining this sequence what is the proper reading frame of the open reading frame? (+1, +2, +3, -1, -2, or -3). d) What would you predict the peptide sequence to be if there was the following mutation that led to a base change: 5’-ACTGATGCATGCCAGGGGTTTTCAACTAAAATGAAA-3’arrow_forward
- GGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotypearrow_forwardHow does our body make protein? I This copy - mRNA - travels from the nucleus of the cell to the part of the cell known as the cytoplasm, which houses ribosomes. Ribosomes are complex machinery in the cells that are responsible for making proteins.II. The cell then expresses the protein and it, in turn, carries out its designated function in the cell on the body.III.Through a process known as transcription, an RNA copy of a DNA sequence for creating a given protein is made.IV. Then, through another process known as translation, ribosomes 'read' the mRNA, and follow the instructions, creating the protein step by step a,II-III-IV b,I-IV-II c.II, I, III, IV d,II-IV-Iarrow_forwardQuestion:- Which statement below about gene expression is TRUE? A. Transcription initiation begins when RNA polymerase bind to the transcription start site. B. RNA processing removes exons, adds a 3' cap, and adds and 5' tail. C. Translation terninates when a tRNA carrying methionine binds to a codon. D. The same amino acid may be encoded by multiple different 3-base codons.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY