Concept explainers
Case summary:
A sixth-grade boy in California carried the mutation for CFTR (Cystic fibrosis Transmembrane conductance regulator) genes. He was transferred out of the middle school because school administrators thought that his mutation would pose a risk for the other students having cystic fibrosis at the school. After missing 11 days of school, a settlement has reached to the boy’s home to take him back to the school.
Characters in the case:
A boy in Palo Alto, California.
Adequate information:
A boy was having a mutation in the CFTR gene and the school administrators transferred him out of the middle school. They thought that the boy’s mutation for CFTR genes would pose a risk for other students at the school having the cystic fibrosis. By keeping in view to the Genetic Information Nondiscrimination Act, a settlement has reached to boy’s home for taking him back to the school.
To determine:
The ethical problems associated with this case and the concerns associated with the Genetic Information Non-discrimination Act (GINA).
Want to see the full answer?
Check out a sample textbook solutionChapter 19 Solutions
EBK ESSENTIALS OF GENETICS
- Two types of mutations discussed in this chapter are (1) nucleotide changes and (2) unstable genome regions that undergo dynamic changes. Describe each type of mutation.arrow_forwardWhat happens if there is too much p16-ink4a in a juvenile and elderly human? what happens if a juvenile produces a mutation form that lacks activity?arrow_forwardIf a base was added or deleted and the reading frame shifted, this would be an example of a ___________________ mutation.arrow_forward
- Let’s say, you want to deliver a gene into a cell and in your lab, there are lot of options available to do that. Describe five different options that you can use to deliver that gene.arrow_forwardGeneticists often use ethylmethane sulfonate (EMS) to induce mutations in Drosophila. Why is EMS a mutagen of choice for genetic research? What would be the effects of EMS in a strain of Drosophila lacking functional mismatch repair systems?arrow_forwardWhich of the following is not an example of a transversion mutation? a) T·A -> C·G b) G·C -> C·G c) T·A -> G·C d) C·G -> A·T e) A·T -> T·Aarrow_forward
- What type of mutation (missense, silent, and non-sense) was introduced in your sequence when G was substituted with C?arrow_forwardHuntington disease (HD) can arise from a rare, short, in-frame addition of CAG nucleotide triplets within the huntingtin (HTT) gene coding region, which creates a disease-causing allele with the symptoms only appearing later in life. Using this information, describe an experiment that could be undertaken to determine whether a currently healthy young individual is a carrier of the HD-causing mutation. Describe the method you would use and how you would interpret the results of this experiment.arrow_forwardWhat is a A hypomorphic mutation?arrow_forward
- What is a silent mutation? Why is the name “silent mutation” a bit of a misnomer?arrow_forwardFrom Table 20-3, would you expect the noncoding mutation g4205a to be fixed before or after the coding mutation G238S in a population of bacteria evolving resistance to the antibiotic cefotaxime? Give at least tworeasons for your answer.arrow_forwardThe following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairingarrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning