Anatomy & Physiology
1st Edition
ISBN: 9781938168130
Author: Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher: OpenStax College
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 2, Problem 30RQ
In DNA,
- beta chain
- pleated sheet
- alpha helix
- double helix
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
In DNA, nucleotide bonding forms a compound with a characteristic shape known as a(n) ________.a. beta chainb. pleated sheetc. alpha helixd. double helix
In one paragraph, using your own words, describe the structure of DNA. Be sure to include the following terms: nucleotide, phosphate, adenine, cytosine, guanine, and thymine.
These two parts of a DNA nucleotide will always stay the same ___________ and _________.
Chapter 2 Solutions
Anatomy & Physiology
Ch. 2 - Visit this website...Ch. 2 - Visit this website...Ch. 2 - Watch this video...Ch. 2 - Together, just four elements make up more than 95...Ch. 2 - The smallest unit of an element that still retains...Ch. 2 - The characteristic that gives an element its...Ch. 2 - On the periodic table of the elements, mercury...Ch. 2 - Nitrogen has an atomic number of seven. How many...Ch. 2 - Which of the following is a molecule, but not a...Ch. 2 - A molecule of ammonia contains one atom of...
Ch. 2 - When an atom donates an electron to another atom,...Ch. 2 - A substance formed of crystals of equal numbers of...Ch. 2 - Which of the following statements about chemical...Ch. 2 - The energy stored in a foot of snow on a steep...Ch. 2 - The bonding of calcium, phosphorus, and other...Ch. 2 - ABA+B is a general notation for a(n) ________...Ch. 2 - __________ reactions release energy. Catabolic...Ch. 2 - Which of the following combinations of atoms is...Ch. 2 - Chewing a bite of bread mixes it with saliva and...Ch. 2 - CH4 is methane. This compound is ________....Ch. 2 - Which of the following is most likely to be found...Ch. 2 - Jenny mixes up a batch of pancake batter, then...Ch. 2 - A substance dissociates into K+ and Cl- in...Ch. 2 - Ty is three years old and as a result of a stomach...Ch. 2 - C6H12O6 is the chemical formula for a ________....Ch. 2 - What organic compound do brain cells primarily...Ch. 2 - Which of the following is a functional group that...Ch. 2 - A pentose sugar is a part of the monomer used to...Ch. 2 - A phospholipid ________. has both polar and...Ch. 2 - In DNA, nucleotide bonding forms a compound with a...Ch. 2 - Uracil ________. contains nitrogen is a pyrimidine...Ch. 2 - The ability of an enzymes active sites to bind...Ch. 2 - The most abundant elements In the foods and...Ch. 2 - Oxygen, whose atomic number is eight, has three...Ch. 2 - Magnesium is an important element in the human...Ch. 2 - Explain why CH4 is one of the most common...Ch. 2 - In a hurry one day, you merely rinse your lunch...Ch. 2 - Could two atoms of oxygen engage in ionic bonding?...Ch. 2 - AB+CDAD+BE Is this a legitimate example of an...Ch. 2 - When you do a load of laundry, why do you not just...Ch. 2 - The pH of lemon juice is 2, and the pH of orange...Ch. 2 - During a party, Eli loses a bet and is forced to...Ch. 2 - If the disaccharide maltose is formed from two...Ch. 2 - Once dietary fats are digested and absorbed, why...
Additional Science Textbook Solutions
Find more solutions based on key concepts
By taking the slope of the curve in Figure 2.63, verify that the acceleration is 3.2 m/s2 at t=10 s.
College Physics
What may happen if the input of a mineral nutrient into an ecosystem is less than the output of that element fr...
Study Guide for Campbell Biology
If someone at the other end of a room smokes a cigarette, you may breathe in some smoke. The movement of smoke ...
Campbell Essential Biology with Physiology (5th Edition)
Define histology.
Fundamentals of Anatomy & Physiology (11th Edition)
The light reactions of photosynthesis supply the Calvin cycle with A. light energy. B. CO2 and ATP. C. O2 and N...
Campbell Biology in Focus
Fibrous connective tissue consists of ground substance and fibers that provide strength, support, and flexibili...
Human Biology: Concepts and Current Issues
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which is not a nucleotide base in DNA? a. adenine b. guanine c. glutamine d. thymine e. cytosine f. All are in DNA.arrow_forwardIn DNA polymer, one nucleotide joins with its neighboring nucleotide at 5' carbon. is it true or falsearrow_forwardThe primary structure of DNA is held together with ___________ bonds, and the secondary structure is held together with _____________ bonds.arrow_forward
- A researcher is studying the effect of pH on a nucleic acid assuming it is DNA.She adds the nucleic acid in a tube labeled pH = 13. Sometime later when sheexamines the structure, she sees broken strands with cyclic structures formed involving phosphate group. a. (question) Do you agree that the nucleic acid is DNA? Why or why not?arrow_forwardWhat type of bond is the arrow pointing to in this image of DNA? -Hydrogen Bond-Covalent Bond-Ionic Bondarrow_forwardWhich of the following is cytidine? cytosine + guanine ribose + cytosine + phosphate group ribose + cytosine cytosine + deoxyribosearrow_forward
- Which of the following make up a nucleotide? phosphate + sugar base + sugar base + sugar + phosphate sugar + phosphatearrow_forwardI am in Microbiology and the question is how would I turn the following DNA strands to primary protein structure? a. TACCCGGTCAAGGACTCCATT b. TTACCGGCTCCGAATGACTTTTarrow_forwardDNA is composed of ___________, which are attached to each other by _______________ bonds. A) amino acids… hydrogen B) nucleotides…. phosphodiester C) monosaccharides… glycosidic D) amino acids… peptide E) nucleotides… hydrogenarrow_forward
- dna nucleotides cannot h-bond to rna nucleotides. true or falsearrow_forwardDNA molecules with complementary sticky ends associate by (a) covalent bonds (b) hydrogen bonds (c) ionic bonds (d) disulfide bonds (e)phosphodiester linkagesarrow_forwardConsider an intact length of DNA consisting of 140 total nucleotides (70 nucleotides/strand), with 40 total adenine nitrogen bases. How many of each of the following molecules would be found in the length? MoleculeNumber Adenine40 Guanine___ Thymine___ Deoxyribose___ Uracil___ Phosphate Groups___ Ribose___ Cytosine___arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license