GENETICS:ANALYSIS+PRIN.(LL)-W/ACCESS
6th Edition
ISBN: 9781260239775
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 20, Problem 17CONQ
Summary Introduction
To review:
The characteristics of a TE (transposable element) in chromosomal DNA (deoxyribonucleic acid).
Introduction:
The eukaryotic chromosomes include protein packaging which is done with the help of chaperone proteins, which on binding and condensation of DNA molecule further prevents the molecule from tangling. During cell division in the metaphase, chromosomes are visible if seen through a light microscope.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A DNA sequence can be represented as a string of the letters ACTG (short for adenine, cytosine, guanine, and thymine).
(a) How many DNA sequences are exactly 24 letters long?
(b) Given a DNA sequence of length 24, how many single letter mutations are possible?
(c) Given a DNA sequence of length 24, how many double letter mutations are possible?
How many adenine bases are there if there are eight thousand cytosine bases in a fifteen thousand bp DNA?
a) Explain the difference between a genome and a transcriptome. Do all cells in an
organism have the same genomes and or transcriptomes?
b) Explain a method you could use to compare transcriptomes, and what you can
learn from comparing transcriptomes.
Chapter 20 Solutions
GENETICS:ANALYSIS+PRIN.(LL)-W/ACCESS
Ch. 20.1 - 1. Homologous recombination refers to the exchange...Ch. 20.1 - During the molecular process of homologous...Ch. 20.1 - 3. A key difference between the original Holliday...Ch. 20.1 - Which of the following mechanisms can cause gene...Ch. 20.2 - 1. During site-specific recombination that occurs...Ch. 20.2 - Prob. 2COMQCh. 20.3 - Which of the following types of transposable...Ch. 20.3 - Prob. 2COMQCh. 20.3 - Prob. 3COMQCh. 20 - 1. Describe the similarities and differences...
Ch. 20 - Prob. 2CONQCh. 20 - 3. Which steps in the double-strand break model...Ch. 20 - Prob. 4CONQCh. 20 - Prob. 5CONQCh. 20 - Prob. 6CONQCh. 20 - Prob. 7CONQCh. 20 - 8. What is gene conversion?
Ch. 20 - Make a list of the differences between the...Ch. 20 - Prob. 10CONQCh. 20 - Prob. 11CONQCh. 20 - 12. According to the double-strand break model,...Ch. 20 - What type of DNA structure is recognized by RecG...Ch. 20 - Briefly describe three ways that antibody...Ch. 20 - 15. Describe the functions of the RAG1 and RAG2...Ch. 20 - According to the scenario shown in Figure 20.7,...Ch. 20 - Prob. 17CONQCh. 20 - Prob. 18CONQCh. 20 - 19. Why does transposition always produce direct...Ch. 20 - 20. Which types of TEs have the greatest potential...Ch. 20 - Prob. 21CONQCh. 20 - 22. Let’s suppose that a species of mosquito has...Ch. 20 - This chapter describes different types of TEs,...Ch. 20 - Prob. 24CONQCh. 20 - Prob. 25CONQCh. 20 - 26. What is the difference between an autonomous...Ch. 20 - 1. Briefly explain how McClintock determined that...Ch. 20 - The work of McClintock showed that the presence of...Ch. 20 - 3. In your own words, explain the term transposon...Ch. 20 - Prob. 4EQCh. 20 - 5. Gerald Rubin and Allan Spradling devised a...Ch. 20 - Make a list of the similarities and differences...Ch. 20 - Prob. 2QSDCCh. 20 - Prob. 3QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What percentage of the DNA in the genome actually corresponds to genes? How much is actually protein-coding exons? What makes up the rest?arrow_forwardUsing a laser beam, you isolated several R bands from human chromosomes. Answer the following questions What kinds of genes are present in R bands? Which isochors do you expect to be present in the R band? What class of interspersed repeats will be present in R bands? What class of tandem repeats do you expect to find in RG bands? Would you expect to find telomere sequences in some R bands?arrow_forwardYou have isolated a new bacteriophage and determined that the composition of its is nucleic acid is 17% A, 26% C, 34% G, and 23% T. What would you conclude about its genome? (One sentence, please)arrow_forward
- Which of the following types of enzymes is primarily responsible for setting up the genetic code? 1.) Kinases 2.) DNA ligase 3.) DNA gyrase 4.) peptidyl transferase 5.) aminoacyl tRNA synthetases (charging enzymes)arrow_forwardWhat does it mean to sequence a genome?arrow_forwardIf you know the sequence of amino acids in a protein, what does the genetic code table allow you to infer about the sequence of base pairs in the gene that specifies that protein?arrow_forward
- The following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA GTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do not begin and end at the same location. Try to line them up according to their homologous regions.arrow_forwardIn the figure below, the coding sequence for gene F is read from left to right, and the coding sequence for gene G is read from right to left. 1.) Top OR Bottom Strand 2.) Top OR Bottom Strandarrow_forwardWhat do the enzymes topoisomerase I and topoisomerase II have in common? a) They both have nuclease activity. b) They both create double-strand DNA breaks. c) They both require ATP hydrolysis for their function. d) They both can create winding (tension) in an initially relaxed DNA molecule. e) All of the above.arrow_forward
- In 1953, Watson and Crick discovered the structure of DNADNA by examining data from many different experiments. How did using Chargaff’s data help Watson and Crick determine the structure of DNADNA?arrow_forwardThe human genome has 3.3 billion bases, of which 3% codes for protein. If a codon were four letters instead of three, what percentage of the genome would have to code to generate the amount of protein?arrow_forwardI mutation occurs such that the sequence now reads: CTA CTT TTT. A) Transcribe the short DNA sequence. B) translate this short DNA sequence. C) what type of point mutation is this? A mutation occurs such that the sequence now reads: CTA GTC TTT. 1)transcribe this short DNA sequence. 2. Translate this short DNA sequence. 3. What type of point mutation is this?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license