GENETICS:ANALYSIS+PRIN.(LL)-W/ACCESS
6th Edition
ISBN: 9781260239775
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 20.1, Problem 4COMQ
Which of the following mechanisms can cause gene conversion?
a. DNA mismatch repair
b. DNA gap repair
c. Resolution of a Holliday junction
d. Both a and b can result in gene conversion.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Xeroderma pigmentosa (XP):
A. is caused by a defect in the mismatch repair system.
B. typically results in base substitution mutations.
C. can be caused by defects in any of a number of different genes that have to do with DNA repair.
D. results when an individual does not spend enough time outside.
E. Can be corrected by a direct repair mechanism
The process by which thymine dimers
are directly repaired with the help of
visible light is called
Select one:
a. photosynthesis
b. excision repair
c. recombination
d. photoreactivation
Which of the following statements are correct about DNA Repair in mammals (select all that apply)?
A.
The Mismatch Repair System is primarily responsible for repairing covalent chemical modification of DNA bases
B.
Over 150 proteins are involved in DNA Repair
C.
Without DNA repair systems we would all likely die of cancer at a young age.
D.
Many DNA Repair enzymes are weakly expressed in tissues of the central nervous system making the CNS more susceptible to some carcinogens.
E.
Cancer cells possess a mutator phenotype
Chapter 20 Solutions
GENETICS:ANALYSIS+PRIN.(LL)-W/ACCESS
Ch. 20.1 - 1. Homologous recombination refers to the exchange...Ch. 20.1 - During the molecular process of homologous...Ch. 20.1 - 3. A key difference between the original Holliday...Ch. 20.1 - Which of the following mechanisms can cause gene...Ch. 20.2 - 1. During site-specific recombination that occurs...Ch. 20.2 - Prob. 2COMQCh. 20.3 - Which of the following types of transposable...Ch. 20.3 - Prob. 2COMQCh. 20.3 - Prob. 3COMQCh. 20 - 1. Describe the similarities and differences...
Ch. 20 - Prob. 2CONQCh. 20 - 3. Which steps in the double-strand break model...Ch. 20 - Prob. 4CONQCh. 20 - Prob. 5CONQCh. 20 - Prob. 6CONQCh. 20 - Prob. 7CONQCh. 20 - 8. What is gene conversion?
Ch. 20 - Make a list of the differences between the...Ch. 20 - Prob. 10CONQCh. 20 - Prob. 11CONQCh. 20 - 12. According to the double-strand break model,...Ch. 20 - What type of DNA structure is recognized by RecG...Ch. 20 - Briefly describe three ways that antibody...Ch. 20 - 15. Describe the functions of the RAG1 and RAG2...Ch. 20 - According to the scenario shown in Figure 20.7,...Ch. 20 - Prob. 17CONQCh. 20 - Prob. 18CONQCh. 20 - 19. Why does transposition always produce direct...Ch. 20 - 20. Which types of TEs have the greatest potential...Ch. 20 - Prob. 21CONQCh. 20 - 22. Let’s suppose that a species of mosquito has...Ch. 20 - This chapter describes different types of TEs,...Ch. 20 - Prob. 24CONQCh. 20 - Prob. 25CONQCh. 20 - 26. What is the difference between an autonomous...Ch. 20 - 1. Briefly explain how McClintock determined that...Ch. 20 - The work of McClintock showed that the presence of...Ch. 20 - 3. In your own words, explain the term transposon...Ch. 20 - Prob. 4EQCh. 20 - 5. Gerald Rubin and Allan Spradling devised a...Ch. 20 - Make a list of the similarities and differences...Ch. 20 - Prob. 2QSDCCh. 20 - Prob. 3QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A.) There is no change in the DNA sequence if nucleotides are added or removed, it will have no effect to the cell. B.) Mutations in the DNA sequence are all irreversible. A. Statement A is correct B. Statement B is correct C. Both A and B are correct D. Both A and B are incorrectarrow_forwardTransposition is a process in which a discrete DNA entity can move between DNA sites that lack homology using a self-encoded protein called a: a. kinase b. transposase c. mobilase d. recombinasearrow_forwardWhich of the following statements correctly identifies whether the indicated mutation is a transition or transversion mutation? A. A=T to G≡C is a transversion mutation. B. C≡G to A=T is a transversion mutation. C. T=A to C≡G is a transversion mutation. D. G≡C to T=A is a transition mutation.arrow_forward
- Which of the following is not an example of a point mutation? a. nonsense b. sense c. antisense d. missensearrow_forwardWhich ONE of the following is TRUE concerning the so‐called Philadelphia chromosome? Select one: A.It results in loss of BCR serine‐threonine kinase activity B.It leads to generation of a fusion protein with constitutively active tyrosine kinase activity C.It results from a t(8;21) translocation D.Overexpression of the ABL1 gene results from a translocation that brings a strong gene promoter close to the ABL1 genearrow_forwardWhich of the following molecules helps relieve the tension of unwinding parental DNA strands, by breaking DNA and rejoining it before it is replicated? a. Primase b. Single-stranded binding proteins c. Helicase d. Topoisomerasearrow_forward
- Unusually high levels of Mdr1 provide stem cells with a. Nutrients needed b. Protection of their genomes from mutagenic agents c. Apoptotic factors d. Ability to differentiatearrow_forwardWhich ONE of the following genetic patterns defines a patient with acute myeloid leukaemia with the most favourable prognosis? Select one: A.Deletion of chromosome 5 B.Normal karyotype with FLT3 tyrosine kinase domain mutation C.t(8;21) translocation D.Deletion of chromosome 7arrow_forwardWhich of the following is true about the enzyme telomerase? A. It is found only in adult cells. B. It is responsible for telomere shortening. C. It can re-establish telomere length. D. It may speed up the aging process. E. It is expressed at low levels in cancer cells.arrow_forward
- which of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruisesarrow_forwardThe action of ultraviolet radiation on DNA to induce mutation is the Select one: a. methylation of base pairs b. deletion of base pairs c. formation of thymine dimers d. addition of base pairsarrow_forwardWhich of the following is not a factor that increases mutations? A. replication errors B. ionizing radiation C. UV radiation D. repair enzymesarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY