Campbell Biology: Custom Edition
18th Edition
ISBN: 9781323717271
Author: Urry, Cain, Wasserman, Minorsky, Reece
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 20, Problem 8TYU
Which Ii of the following sequences in double-stranded DNA is most likely to be recognized as a cutting site for a restriction enzyme?
(A) AAGG
TTCC
(B) GGCC CCGG
(C) ACCA TGGT
(D) AAAA TTTT
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
please do only part D .
The following diagram shows one-half of a restriction site.
(a) Draw the other half.
GAC G I C
(b) Use heavy arrows (↑1) to identify type II cleavage sites that
would yield blunt-ended duplex DNA products.
(c) Use light arrows (T1) to identify type II cleavage sites yielding
staggered cuts that could be converted directly to recombinant DNA
molecules by DNA ligase, with no other enzymes involved.
(d) If this were the recognition site for a type I restriction endonu-
clease, where would cutting of the duplex occur?
(e) If DNA sequences were completely random, how large an inter-
val (in kilobase pairs) would you expect between identical copies of
this sequence in DNA?
A) For this DNA fragment
(from 5' to 3')
"TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA",
what is its complementary strand
B) What are the products when the DNA with the above sequence is incubated with the restriction enzyme EcoRI
C) What are the products when the DNA with the above sequence is incubated with the restriction enzyme Mspl
D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key elements of the molecule
including the bonds involved
Chapter 20 Solutions
Campbell Biology: Custom Edition
Ch. 20.1 - Prob. 1CCCh. 20.1 - DRAW IT One Strand of a DNA molecule has the...Ch. 20.1 - What are some potential difficulties in using...Ch. 20.1 - VISUAL SKILLS Compare Figure 20.7 with Figure...Ch. 20.2 - Prob. 1CCCh. 20.2 - Prob. 2CCCh. 20.3 - Based on current knowledge, how would you explain...Ch. 20.3 - Prob. 2CCCh. 20.3 - Prob. 3CCCh. 20.4 - What is the advantage of using stem cells for gene...
Ch. 20.4 - Prob. 2CCCh. 20.4 - Prob. 3CCCh. 20 - Describe how the process of gene doning results in...Ch. 20 - What useful Information is obtained by detecting...Ch. 20 - Describe how, using mice. a researcher could carry...Ch. 20 - What factors affecf whether a given genetic...Ch. 20 - In DNA technology, the term vector can refer to...Ch. 20 - Which of the following tools of DNA technology is...Ch. 20 - Prob. 3TYUCh. 20 - A paleontologist has recovered a bit of tissue...Ch. 20 - DNA technology has many medical applications....Ch. 20 - Which of the following is not true of cDNA...Ch. 20 - Expression of a cloned eukaryotic gene in a...Ch. 20 - Which Ii of the following sequences in...Ch. 20 - Prob. 9TYUCh. 20 - MAKE CONNECTIONS Looking at Figure 20.15, what...Ch. 20 - DRAW IT You are cloning an aardvark gene, using a...Ch. 20 - EVOLUTlON CONNECTION Ethical considerations aside,...Ch. 20 - Prob. 13TYUCh. 20 - Prob. 14TYUCh. 20 - The water in the Yellowstone National Park hot...
Additional Science Textbook Solutions
Find more solutions based on key concepts
How does trandlation differ from transcription?
Microbiology: Principles and Explorations
True or false? Some trails are considered vestigial because they existed long ago.
Biological Science
WHAT IF? As a cell begins the process of dividing, its chromosomes become shorter, thicker, and individually vi...
Campbell Biology in Focus (2nd Edition)
Define histology.
Fundamentals of Anatomy & Physiology Plus Mastering A&P with eText - Access Card Package (10th Edition) (New A&P Titles by Ric Martini and Judi Nath)
Jellyfish Lake, located on the Pacific island of Palau, is home to millions of jellyfish. Many years ago, sea l...
BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
11. In the early 1800s, French naturalist Jean Baptiste Lamarck suggested that the best explanation for the rel...
Campbell Biology: Concepts & Connections (9th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- iarrow_forwardplease helparrow_forward1. Look at the cut DNA sequences shown below in i) and ii). a) What restriction enzyme(s) was/were used to create these sequences? b) Could the sequences below be hybridized and ligated? c) If it is possible to join these two sequences by hybridization and ligation what would happen if the resulting sequence was again exposed to the original restriction enzyme(s) that you identified? You must defend any answers that you make with logic at the level of course content. i. 5'-G 3'-CCTAG ii. GATCT-3' A-5'arrow_forward
- Given the following double-stranded fragment of DNA: 5'- ACTTGGCAGGCCTTCGATCC-3' 3'- TGAАССGTCСGGAAGCTAGG-5' A hypothetical restriction endonuclease recognizes a 6bp sequence with two-fold symmetry (typical for restriction enzymes) found in this fragment and catalyzes cleavage of this DNA on both strands between GG nucleotides within the recognition sequence. This nuclease exhibits b-type cleavage (atypical for restriction enzymes). Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the ends.arrow_forwardWhen joining two or more DNA fragments, a researcher can adjust the sequence at the junction in a variety of subtle ways, as seen in the following exercises.(a) Draw the structure of each end of a linear DNA fragment produced by an EcoRI restriction digest (include those sequences remaining from the EcoRI recognition sequence).(b) Draw the structure resulting from the reaction of this end sequence with DNA polymerase I and the four deoxynucleoside triphosphates.(c) Draw the sequence produced at the junction that arises if two ends with the structure derived in (b) are ligated (d) Draw the structure produced if the structure derived in (a) is treated with a nuclease that degrades only single-stranded DNA.(e) Draw the sequence of the junction produced if an end with structure (b) is ligated to an end with structure (d).(f) Draw the structure of the end of a linear DNA fragment that was produced by a PvuII restriction digest (include those sequences remaining from the PvuII recognition…arrow_forwardYou prepare a reaction mix containing (i) DNA polymerase III, (ii) DATP, DCTP, dGTP, Mg2+, and 2,3'dideoxy-TTP (called ddTTP*), (iii) a short primer with the sequence 5'-CCTG-3, and (iv) a source DNA fragment with the sequence, 5'-AATCGTTCACGTTAGCAGG-3. What is the product of this reaction? Note that in ddTTP, both the 2' and 3' positions on the ribose sugar lack hydroxyl groups. No reaction, because the primer is not complementary to any sequence in the source DNA. O CCTGCT O CCTGC O T'T'AGCAAGT'GCAAT CGTCC O CCTGCT'AACGT GAACGAT'Tarrow_forward
- The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given abovearrow_forwardYou are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA encoding this peptide is included in the sequence shown below. 5'-CGTGACGGCTCGTGGAAGCTAGTCATC-3' 3'-GCACTGCCGAGCACCTTCGATCAGTAG-5' This sequence does not contain any BamHI restriction enzyme sites. The target sequence for the BamHI restriction nuclease is GGATCC. Your goal is to create a BamHI site on this plasmid by manipulating the DNA sequence, without changing the coding sequence of the protein. How would you do this, ie what would the new sequence be?arrow_forward1) Restriction enzymes come in a concentration of U/ml, and it is recommended that 1U be used for each ug of DNA to be digested. If an enzyme you want to use comes in at 22,000 U/ml, and you want to digest 5 ug of DNA. How much volume will you have to use for the reaction and how will you be able to measure it with the pipettes we have in the lab? 2) An enzyme for ligation (Cip) comes at a concentration of 16000 units/ml. How many units will there be in 10 ul?arrow_forward
- (i) Indicate by drawing where the RNA of Telomerase binds to the telomeric region. W, X, Y, and Z are the ends of the DNA and RNA strands respectively. Identify ends of DNA’s X, Y, and Z shown in Figure 1(a) & (b). (ii) (a) Telomerase -AAUCCCAAU- TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W’ AАТСССААТСССААТСССАА-Х" (b) Telomeric DNA Figure 1arrow_forwardWhich of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA binding protein? (Note that only one strand of the DNA is shown - you will find it helpful to write down the sequence and the sequence of the opposite strand to answer this question.) a) 5’- G A G C G A T C G C T C - 3’ b) 5’- G A G C G A G A G C G A - 3’ c) 5’- G A G C G A A G C G A G - 3’arrow_forwardAlthough DNA polymerases require both a template and a primer, the following single-stranded polynucleotide was found to serve as a substrate for DNA polymerase in the absence of any additional DNA.3′ HO-ATGGGCTCATAGCCGGAGCCCTAACCGTAGACCACGAATAGCATTAGG-p 5′What is the structure of the product of this reaction?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license