CAMPBELL BIOLOGY W/MASTERINGBIO CODE >
16th Edition
ISBN: 9781323573457
Author: Campbell
Publisher: PEARSON C
expand_more
expand_more
format_list_bulleted
Question
Chapter 20, Problem 9TYU
Summary Introduction
To explain: The cloning of the human crystallin gene to obtain a sufficient amount of the human crystallin protein.
Concept introduction:
Protein encoding genes express themselves and form functional gene products in the form of proteins. This is known as gene expression. Generally, polymerase chain reaction (PCR) is used for the amplification of the gene sequence of interest and to synthesize its multiple copies. This gene fragment is then inserted into the expression vector to synthesize the protein encoded by the gene.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
MAKE CONNECTIONS Mutagens are chemical andphysical agents that induce mutations in DNA (seeConcept 17.5). How does reduced ozone concentrationin the atmosphere increase the likelihood of mutationsin various organisms?
Give typed full explanation
there are about 28,000 copies of zinc finger domains in the human genome, most of them as constituents of transcribed genes. This is a result of what process?
Retro transposition of mobile sequences
Evolutionary conservation, exon duplication and exon shuffling
Evolutionary conversion of leucine zipper, helix-turn-helix, and helix-loop-helix domains into zinc finger domains
Evolutionary selection for proteins that interfere with nucleosome packing
Genes that “jump” with the help of a transposase.
Q.)
A.)Search in human genome if any examples of mRNA translated from 2 different sites?and give examples?
B.)aminoacyl tRNA synthetase is specialized or not ? And why?
Chapter 20 Solutions
CAMPBELL BIOLOGY W/MASTERINGBIO CODE >
Ch. 20.1 - Prob. 1CCCh. 20.1 - DRAW IT One Strand of a DNA molecule has the...Ch. 20.1 - What are some potential difficulties in using...Ch. 20.1 - VISUAL SKILLS Compare Figure 20.7 with Figure...Ch. 20.2 - Prob. 1CCCh. 20.2 - Prob. 2CCCh. 20.3 - Based on current knowledge, how would you explain...Ch. 20.3 - Prob. 2CCCh. 20.3 - Prob. 3CCCh. 20.4 - What is the advantage of using stem cells for gene...
Ch. 20.4 - Prob. 2CCCh. 20.4 - Prob. 3CCCh. 20 - Describe how the process of gene doning results in...Ch. 20 - What useful Information is obtained by detecting...Ch. 20 - Describe how, using mice. a researcher could carry...Ch. 20 - What factors affecf whether a given genetic...Ch. 20 - In DNA technology, the term vector can refer to...Ch. 20 - Which of the following tools of DNA technology is...Ch. 20 - Prob. 3TYUCh. 20 - A paleontologist has recovered a bit of tissue...Ch. 20 - DNA technology has many medical applications....Ch. 20 - Which of the following is not true of cDNA...Ch. 20 - Expression of a cloned eukaryotic gene in a...Ch. 20 - Which Ii of the following sequences in...Ch. 20 - Prob. 9TYUCh. 20 - MAKE CONNECTIONS Looking at Figure 20.15, what...Ch. 20 - DRAW IT You are cloning an aardvark gene, using a...Ch. 20 - EVOLUTlON CONNECTION Ethical considerations aside,...Ch. 20 - Prob. 13TYUCh. 20 - Prob. 14TYUCh. 20 - The water in the Yellowstone National Park hot...
Knowledge Booster
Similar questions
- Project: You want to make a cat that glows in the dark (its nose, ears, and tail should glow). Choose the best answer. 9) To get started on this project, you isolate and cut out the gene in a jellyfish that codes for the green fluorescent protein (GFP). The next thing you need to do is attach this gene to the correct promoter so that you can be sure it is expressed appropriately in the cat. Which of the following promoters should you use? a) any promoter is fine b) the original promoter found in the jellyfish c) a promoter from a gene that is expressed in cells of the cat's nose, ears, and tail 10) You are now ready to transfer the piece of recombinant DNA you have prepared to the cat. You want to be sure that the transgenic cat you create will be able to pass the fluorescence on to its offspring. What is the best type of cell to transfer the recombinant DNA to? a) an unfertilized egg b) a fertilized egg c) somatic cells of an adult catarrow_forwardMAKE CONNECTIONS Compare the CRISPR-Cas systemto the miRNA system discussed in Concept 18.3, includingtheir mechanisms and their functions.arrow_forwardEVOLUTION LINK DNA technology, such as the production of transgenic animals, is possible only because widely different organisms have essentially identical genetic systems (DNA RNA protein). What is the evolutionary significance of the universality of genetic systems in organisms as diverse as bacteria and pigs?arrow_forward
- Analyzing Cloned Sequences What kind of information can a DNA sequence provide to a researcher studying a disease-causing gene?arrow_forwardWHAT IF? In eukaryotic cells, mRNAs have been foundto have a circular arrangement in which proteins holdthe poly-A tail near the 5¿ cap. How might this increasetranslation efficiency?arrow_forwardtry w1 II. In each of the following DNA sequences, write on your answer sheet the corresponding mRNAtranscript and use the genetic code to determine the resulting amino acid sequence. Note that the givenstrands are in the 3’ to 5’ direction. Start the amino acid sequence with the start codon and end withstop codon.1. TTTTACCATCCCACAATTTA mRNA: _________________________ Amino acids: _____________________ 2. ACTACTTTCAGAGCTATATTCAG mRNA: _________________________ Amino acids: _____________________arrow_forward
- Q1. Predict the effects (on translation of coat gene and replicase gene) of the following mutations on phage R17 coat gene and replicase gene translation and explain the logic of your answers: a. An amber mutation (premature stop codon) six codons downstream of the coat gene initiation codon. b. Mutations in the stem loop around the coat gene initiation codon that weakens the base-pairing in the stem loop. c. Mutations in the interior of the replicase gene that cause it to base-pair with the coat gene initiation codon.arrow_forwardMAKE CONNECTIONS How is ligand binding similarto the process of allosteric regulation of enzymes?(See Figure 8.20.)arrow_forwardtransduction.2. Explain how each of these three methods of genetransfer can be used to map bacterial genesarrow_forward
- Reflect on this "Gene therapy is still in its infancy, but its believe that as it matures, it will become an effective treatment for the myriad of genetic diseases that effect humanity ?arrow_forwardVISUAL SKILLS Consider the microarray in Figure 20.12.If a sample from normal tissue is labeled with a green fluorescent dye and a sample from cancerous tissue is labeledred, what color spots would represent genes you would beinterested in if you were studying cancer? Explain.arrow_forwardVISUALIZE Sketch a pyrimidine nucleotide subunit that would be found only in RNA. Circle and label the three components that make up this type of nucleotide. Explain what changes in the functional groups of this subunit would have to occur for it to be found in a DNA molecule.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning