MasteringBiology with Pearson eText -- ValuePack Access Card -- for Campbell Biology
11th Edition
ISBN: 9780134472942
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 20.1, Problem 2CC
DRAW IT Ø One Strand of a DNA molecule has the follow- ing sequence:
5'-CTTGACGATCGTTACCG-3'
Draw the other Strand. Will PvuI (see question 1) cut this molecule? If so, draw the products.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
DRAW IT One strand of a DNA molecule has the following sequence:5’-CTTGACGATCGTTACCG-3’Draw the other strand. Will PvuI (see question 1) cut thismolecule? If so, draw the products
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' .
If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
The DNA nucleotide sequence that's complementary will base pair to a strand of DNA with the following sequence, 5' GTAATC 3' is?
5'GUAAUC3'
3'CATTAG5'
5'CATTAG3'
3'CAUUAG5'
3'GTAATC5'
Chapter 20 Solutions
MasteringBiology with Pearson eText -- ValuePack Access Card -- for Campbell Biology
Ch. 20.1 - Prob. 1CCCh. 20.1 - DRAW IT One Strand of a DNA molecule has the...Ch. 20.1 - What are some potential difficulties in using...Ch. 20.1 - VISUAL SKILLS Compare Figure 20.7 with Figure...Ch. 20.2 - Prob. 1CCCh. 20.2 - Prob. 2CCCh. 20.3 - Based on current knowledge, how would you explain...Ch. 20.3 - Prob. 2CCCh. 20.3 - Prob. 3CCCh. 20.4 - What is the advantage of using stem cells for gene...
Ch. 20.4 - Prob. 2CCCh. 20.4 - Prob. 3CCCh. 20 - Describe how the process of gene doning results in...Ch. 20 - What useful Information is obtained by detecting...Ch. 20 - Describe how, using mice. a researcher could carry...Ch. 20 - What factors affecf whether a given genetic...Ch. 20 - In DNA technology, the term vector can refer to...Ch. 20 - Which of the following tools of DNA technology is...Ch. 20 - Prob. 3TYUCh. 20 - A paleontologist has recovered a bit of tissue...Ch. 20 - DNA technology has many medical applications....Ch. 20 - Which of the following is not true of cDNA...Ch. 20 - Expression of a cloned eukaryotic gene in a...Ch. 20 - Which Ii of the following sequences in...Ch. 20 - Prob. 9TYUCh. 20 - MAKE CONNECTIONS Looking at Figure 20.15, what...Ch. 20 - DRAW IT You are cloning an aardvark gene, using a...Ch. 20 - EVOLUTlON CONNECTION Ethical considerations aside,...Ch. 20 - Prob. 13TYUCh. 20 - Prob. 14TYUCh. 20 - The water in the Yellowstone National Park hot...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Energy that drives the attachment of a nucleotide to the end of a growing strand of DNA comes from ______. a. phosphate-group transfers from ATP b. DNA polymerase c. the nucleotide itself d. a and carrow_forwardA portion of one strand of DNA has the sequence 5′ AATGGCTTA 3′. If this strand is used as a template for DNA replication, write the sequence of the newly synthesized strand in the direction from left to right in which it will be synthesized.arrow_forwardBase on the coding strand of DNA: ATG GGA ATT CGC What is the sequence of the complementary template strand of DNA that pairs with the coding strand?arrow_forward
- One strand of DNA has the base sequence as shown below. Complete the transcription and translation of this strand. Non template strand: 5' A T G T A T G C C A A T G C A 3’ What is the amino acids?arrow_forwardOne strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment?arrow_forwardThe sequence of the DNA template strand is 3’– GACTTCC – 5’ What is the sequence of the DNA informational strand?arrow_forward
- The DNA sequence ATGCATGC will pair with which of the following DNA strands? TACGTACG TACCTACC CGTACGTA ATGCATGC TTGCATCCarrow_forwardDNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, whats the non-template/sense/coding strand from the STARND DNA? also what's the arrangement of m-RNA and the chain arrangement of the amino acids that will be made according to the order of the RNA?PLS DONT ANSWER THE DEFINITION ONLY, READ THE QUESTION CAREFULLYarrow_forwardWrite down the major differences between DNA and RNA.keeping in mind the concept of " central dogma" explain whether the information from protien is transfered to DNA? If yes/ No.explainarrow_forward
- he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′arrow_forwardPolymerases work is to add 10 nucleotides to a DNA strand before dissociating. During replication process, DNA pol III can add tens of thousands of nucleotides at a moving fork. How this additionaccomplished?arrow_forwardDNA pol III synthesizes the leading strand as a continuous strand. The lagging strands are synthesized in segments, called __________arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY