CAMPBELL BIOLOGY MOD MASTERING (18 WEEK)
12th Edition
ISBN: 9780136920335
Author: Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 20.1, Problem 4CC
VISUAL SKILLS Ø Compare Figure 20.7 with Figure 16.20. How does replication of DNA ends during PCR proceed without shortening the fragments each time?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
VISUAL SKILLS Compare Figure 20.7 with Figure 16.20.How does replication of DNA ends during PCR proceedwithout shortening the fragments each time?
TOPIC: PCR and Gene Cloning Basics
Question: What are 2 possible roles of CaCl2 in the transformation process?
Ⓒ Macmillan Learning
The table shows where different restriction endonucleases (restriction enzymes) cleave DNA. The abbreviation R represents the
purines (adenine and guanine). The pyrimidines (cytosine, thymine, and uracil) are abbreviated as Y. The abbreviation W
represents adenine or thymine.
Enzyme
Target sequence
5' GAATTC 3'
3' CTTAAG 5'
EcoRI
ECORV
HaeIII
HindIII
PpUMI
5' GATATC 3'
3' CTATAG 5'
EcoRI
HindIII
EcoRV
HaeIII
5' GGCC 3'
3' CCGG 5'
Incorrect
5' AAGCTT 3'
3' TTCGAA 5'
5' RGGWCCY 3'
3' YCCWGGR 5'
5' TCAGAATTCGGTGA 3'
Cleavage
5' G
3' CTTAA
5' GAT
3' CTA
5' GG
3' CC
AATTC 3'
G5'
ATC 3'
TAG 5'
CC 3'
GG 5'
AGCTT 3'
A 5'
Which restriction endonucleases would cleave a DNA molecule at the given sequences? The complementary DNA substrate
strand is omitted for clarity.
5' A
3' TTCGA
5' RG
GWCCY 3'
3' YCCWG GR 5'
5' TCCAAGCTTGAATTC 3'
EcoRV
HaeIII
HindIII
EcoRI
Incorrect
Macmillan Learning
Chapter 20 Solutions
CAMPBELL BIOLOGY MOD MASTERING (18 WEEK)
Ch. 20.1 - Prob. 1CCCh. 20.1 - DRAW IT One Strand of a DNA molecule has the...Ch. 20.1 - What are some potential difficulties in using...Ch. 20.1 - VISUAL SKILLS Compare Figure 20.7 with Figure...Ch. 20.2 - Prob. 1CCCh. 20.2 - Prob. 2CCCh. 20.3 - Based on current knowledge, how would you explain...Ch. 20.3 - Prob. 2CCCh. 20.3 - Prob. 3CCCh. 20.4 - What is the advantage of using stem cells for gene...
Ch. 20.4 - Prob. 2CCCh. 20.4 - Prob. 3CCCh. 20 - Describe how the process of gene doning results in...Ch. 20 - What useful Information is obtained by detecting...Ch. 20 - Describe how, using mice. a researcher could carry...Ch. 20 - What factors affecf whether a given genetic...Ch. 20 - In DNA technology, the term vector can refer to...Ch. 20 - Which of the following tools of DNA technology is...Ch. 20 - Prob. 3TYUCh. 20 - A paleontologist has recovered a bit of tissue...Ch. 20 - Which of the following is not true of cDNA...Ch. 20 - Expression of a cloned eukaryotic gene in a...Ch. 20 - Which Ii of the following sequences in...Ch. 20 - Prob. 8TYUCh. 20 - MAKE CONNECTIONS Looking at Figure 20.15, what...Ch. 20 - DRAW IT You are cloning an aardvark gene, using a...Ch. 20 - EVOLUTlON CONNECTION Ethical considerations aside,...Ch. 20 - Prob. 12TYUCh. 20 - Prob. 13TYUCh. 20 - Prob. 14TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Order the steps required to sequence a region of DNA using dideoxy sequencing. Amplify the region of DNA to be sequenced add a primer, deoxynucleotides, labeled dideoxynucleotides, and DNA polymerase a primer binds to the single-stranded DNA template DNA polymerase extends the primer, incorporating deoxynucleotides a labeled dideoxynucleotide terminates the growing DNA chain gel electrophoresis separates the mixture of DNA fragments by size The DNA sequence is determined denature the double-stranded DNA Answer Bankarrow_forwardCorrect order ib which the following enzynes would operate to fix a damaged nucleotide in a human gene. a) nuclease, DNA polymerase, RNA primase b) helicase, DNA polymerase, DNA ligase c) DNA ligase, nuclease, helicase d) nuclease, DNA polymerase, DNA ligasearrow_forwardExpand PCR? Describe the different Steps involved in this technique?arrow_forward
- Sensors detect the flash of light. DNA polymerase Unused deoxyribonucleotides are cleaved by apyrase. ATP is consumed by luciferase and light is emitted. AMP and PP, are converted into ATP by sulfurylase. Template strand Growing strand 3' TAGGCCTACACTTACGCGAATGT 5' 5' ATCCGGAT 3' dGTP dNTPs dNDPs dNMPs + P₁ PP₁ ATP [1]arrow_forwardWhat's the main difference between first-generation sequencing, second-generation sequencing and whole genome amplification.arrow_forwardExamine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGACarrow_forward
- Genetic Engineering Process (GEP) # 1: (What kind of process?) Picture A (Sequence #_ DNA introduced into bacterial cells Picture B (Sequence #, DNA ligase added, seals overhangs TTAA AATT AAT AATT TAA TTA TAA PATT PATT AATT recombinant DNA molecules Picture C (Sequence #. donor DNA vector vector and donor DNA digested (cleaved) with restriction enzyme AATT AATT 1477 AATT TTAA overhangs TTAA 1477 Picture D (Sequence #. AATT mixing recombinant DNA molecules replicate and cells dividearrow_forward2AQ:You are cloning the genome of a new DNA virus into pUC18.You plate out your transformants on ampicillin plates containing X-gal and pick one bluecolony and one white colony. When you check the size of the inserts in each plasmid (blueand white), you are surprised to find that the plasmid from the blue colony contains a verysmall insert of approximately 60 bp, while the plasmid from the white colony does notappear to contain any insert at all. Explain these results.arrow_forwardDescribe your amplicon based on molecular size. Comparing the size of the genomic DNA Describe your amplicon based on molecular size. Comparing the size of the genomic DNA (as seen in Fig. 8.1) and the PCR products based on band position in the gel (as seen in Fig. 8.2).arrow_forward
- During agarose gel electrophoresis, why does DNA move through the gel when electric current is applied? because DNA is negatively charged because a charged chemical from the loading buffer is bound to the DNA because DNA is positively charged because DNA absorbs electricityarrow_forwardイト会 Why DNA methylation needed for DNA replication ? * Your answer What is the general way for prolongation of life of organisms ? * Your answer How to design allele specific primers? * Your answer What is the role of non-coding RNAS in DNA replication? * Your answerarrow_forwardAKS 5c: Which student correctly explained what is occurring in the images? AEGCEE ECCUAE FACGAAAGCAEA 3' Met Leu Ser Tyr Tyr Gle Ser le Met Leu Ser Tyr Tyr Glu Ser le The 4th student explains the first arrow must demonstrate how the base pairing rule is being used to replicate a strand of DNA since the complementary pairs are being O lined up for semi conservative replication. The second arrow must demonstrate the process of transcription since the DNA is being read at the ribosomes and the monomers of protein are being connected. The 1st student explains the first arrow must demonstrate how the base pairing rule is being used to replicate a strand of DNA since the complementary pairs are being lined up for semi conservative replication. The second arrow must demonstrate the process of translation since the RNA is being read at the ribosomes and the monomers of protein are being connected. The 2nd student explains the first arrow must demonstrate how the base pairing rulearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License