Campbell Biology (11th Edition)
11th Edition
ISBN: 9780134093413
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 21, Problem 4TYU
DRAW IT Below are the amino acid sequences(using the single-letter code; see Figure 5.14) of four short segments of the FOXP2 protein from six Speeles: chimpanzce (Q, orangutan (()), gorllla (G), rhesus macaque (R), mouse (M), and human (H). These segments contain all of the amino acid differences helween the FOXP2 proteinsof these species.
Use a highlighter to color anv amino acid that varies among the species. (Color that amino acid in all sequences.
- (a) The C, G, R sequences are identical. Identily which lines correspond to those sequences.
- (b) The O sequence differs from the C, G, R speieces at two amino acids. Underilnethetwodlffcrences inthe H sequence.
- (c) The O sequence diffen from the C, G, R sequences at one amino acid (having V instead of A) and from the H sequence at three amino acids. Identify tho O sequence.
- (d) In the M sequence,circle the amino acid(s) that differ from the C, G, R sequence, and draw a square around those that differ from the H sequence.
- (e) Primates and rodents diverged between 60 and IO0 million years ago. and chimpanzees and humans about 6 million years ago. Compare the amino acid differences between the mouse and the C, G, R species with those between the human and the C, G, R species. What can you conclude?
Expert Solution & Answer
Learn your wayIncludes step-by-step video
schedule09:19
Students have asked these similar questions
GTTTTCACTGGCGAGCGTCATCTTCCTACT9. Generate a FULL protein sequence alignment for one of the identified putative protein products with at least one similar invertebrate protein (if there is none, use a vertebrate homolog).
How many binary sequences of length n contain at most five 1 digits? The genetic code specifies an amino acid through a sequence of three nucleotides. Each nucleotide can be of one of the four types T, A, C and G, beingrepetitions allowed. How many amino acids can be encoded in this way?And if there are n types. Compare
You discovered a (tiny) novel protein and figured out that the protein sequence was:
Met-Ala-Arg-Gly-Trp-Ala-Pro
Work backwards (showing your work) to identify 2 possible DNA sequences that might encode your protein.
Sequence 1: ______________________________________________________________________
Sequence 2: ______________________________________________________________________
Based on these sequences, is there anything you could infer about where this organism might live? Could the DNA in your possible sequences be beneficial for any particular environments?
Chapter 21 Solutions
Campbell Biology (11th Edition)
Ch. 21.1 - Describe the whole-genome shotgun approach.Ch. 21.2 - Prob. 1CCCh. 21.2 - Explain the advantage of the systems biology...Ch. 21.2 - MAKE CONNECTIONS The ENCODE pilot project found...Ch. 21.2 - MAKE CONNECTIONS In Concept 20.2, you learned...Ch. 21.3 - The best estimate is that the human genome...Ch. 21.3 - The Genomes Online Database (GOLD) Website of the...Ch. 21.3 - WHAT IF? What evolutionary processes might...Ch. 21.4 - Discuss the characteristics of mammalian genomes...Ch. 21.4 - VISUAL SKILLS Which of the three mechanisms...
Ch. 21.4 - Contrast the organizations of the rRNA gene family...Ch. 21.4 - MAKE CONNECTIONS Assign each DNA segment at the...Ch. 21.5 - Describe three examples of errors in cellular...Ch. 21.5 - Explain how multiple exons might have arisen in...Ch. 21.5 - What are three ways that transposable elements are...Ch. 21.5 - WHAT IF? In 2005, Icelandic scientists reported...Ch. 21 - How did the Human Genome Project result in more...Ch. 21 - What has been the most significant finding of the...Ch. 21 - Compare genome size, gene number, and gene density...Ch. 21 - Explain how the function of transposable elements...Ch. 21 - How could chromosomal rearrangements lead to the...Ch. 21 - What type of Information can be obtained by...Ch. 21 - Bioinformatics intludes all of the following...Ch. 21 - Homeotic genes (A) encode transcription factors...Ch. 21 - Prob. 3TYUCh. 21 - DRAW IT Below are the amino acid sequences(using...Ch. 21 - EVOLUTION CONNECTION Genes important in the...Ch. 21 - scientific inquiry The scientists mapping the SNPs...Ch. 21 - Prob. 7TYUCh. 21 - SYNTHESIZE YOUR KNOWLEDGE Insects have three...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Fibrous connective tissue consists of ground substance and fibers that provide strength, support, and flexibili...
Human Biology: Concepts and Current Issues
In a rapidly changing environment, which bacterial population would likely be more successful, one that include...
Campbell Biology in Focus (2nd Edition)
2. Whether an allele is dominant or recessive depends on
a. how common the allele is, relative to other alleles...
Campbell Biology: Concepts & Connections (9th Edition)
Why is petroleum jelly used in the hanging-drop procedure?
Laboratory Experiments in Microbiology (12th Edition) (What's New in Microbiology)
QUANTITATIVE Punnett Squares as Genetic Tools. The genetic characters of seed color (where Y is the allele for ...
Becker's World of the Cell (9th Edition)
Knowledge Booster
Similar questions
- Gene editing is also used to explore the structure and function ofproteins. For example, changes can be made to the coding sequenceof a gene to determine how alterations in the amino acid sequenceaffect the function of a protein. Let’s suppose that you areinterested in the functional importance of a particular glutamicacid (an amino acid) within a protein you are studying. By geneediting, you make mutant proteins in which the glutamic acidcodon has been changed to other codons. You then test the encodedmutant proteins for functionality. The results are as follows: FunctionalityNormal protein 100%Mutant proteins containingTyrosine 5%Phenylalanine 3%Aspartic acid 94%Glycine 4%From these results, what would you conclude about the…arrow_forwardA very common molecular biology research method is to analyze cell or tissue homogenates by SDS-polyacrylamide gel electrophoresis and immunoblotting (Western blot). What can we learn about a protein of interest from this type of analysis? More than one answer is correct. Options: Determine the tertiary structure of the protein of interest. Determine or verify the molecular weight of the protein of interest. Compare the levels of the protein of interest in two different cell types. Determine the amino acid sequence from the product ion spectrum. Determine the intracellular binding partners of the protein of interest.arrow_forwardTitin is a muscle protein named for its size. Its gene has the largest known coding sequence of 80,781 DNA bases. How many amino acids long is it?arrow_forward
- Consider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forwardSir Bong wanted to determine the a amino acide sequence og BONG. The summary of the analyses performed to the peptide is attached. 1. The three letter designation for the N terminal amino acid residue of CUTE is? 2. The three letter designation for the N terminal amino acid residue of POGI is? 3.The three letter designation for the N terminal amino acid residue of BONG is? 4. The ONE letter designation for the N terminal amino acid residue of CUTE is? 5. The ONE letter designation for the N terminal amino acid residue of POGI is? 6. The ONE letter designation for the N terminal amino acid residue of BONG is? 7.The ONE letter designations for the fragments produced upon treatment of POGI with chymotrypsin are? 8. The ONE letter designations for the fragments produced upon treatment of BONG with thermolysin are?arrow_forwardTake a look at the multiple-sequence alignment shown ofthe globin polypeptides, focusing on amino acids 101 to 148.A. Which of these amino acids are likely to be most important forglobin structure and function? Explain why.B. Which are likely to be least important?arrow_forward
- If you’re comparing the sequences of protein “R” from multiple vertebrates, arthropods, protists, and bacteria, which PAM or BLOSUM matrix would be the most suitable compared to others? Explain your reasoning.arrow_forwardIn the image below, the blue squiggly line represents a folded protein. There are two particular amino acids that are colored red and black in the protein. The structure of each of these two specific amino acids is shown in the indicated box. A mutation occurs in the gene that encodes the protein illustrated above. The result of this mutation is that one of the amino acids above is substituted with another. Specifically, the amino acid whose structure is shaded red above (the one on the left in the illustration) is replaced by the amino acid shown below. Use this information to answer the two questions that follow. Please answer these questions.  1. Based on this description, indicate which type of mutation occurred: missense, nonsense, silent, or indel 2. How would this mutation affect this protein's structure and function? Explain in 2-4 sentences. Be specific, and be sure to include details of these specific amino acids in your response. (I'm giving you the…arrow_forward1. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.) 2. Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Translate the mRNA. (Using the 3-letter code for amino acids, write the primary structure of the peptide that will be produced.)arrow_forward
- A certain small enzyme is needed to extracellularly digest food. The order of the bases on the DNA molecule is ACCAAATCGTTC. What is the order of amino acids on the protein? Explain from start to finish the process by which this protein is created and exported.Please provide all referencesarrow_forwardThe median size protein in humans is 8600 amino acids. How does this compare to if our genome was random (21 amino acids long) Explain the difference.arrow_forwardWhich of the sequences below do you think would most likely be found in an intrinsically disordered protein? GSSKSSKKREPS MVLITTEVKAT MVLITTEVIIAA All of these could be found in an intrinsically disordered proteinarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education