![BIOLOGY-TEXT](https://compass-isbn-assets.s3.amazonaws.com/isbn_cover_images/9781260169621/9781260169621_smallCoverImage.jpg)
BIOLOGY-TEXT
5th Edition
ISBN: 9781260169621
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 21.5, Problem 1CS
Summary Introduction
To propose: A model that can determine the outcome of transposition depending on the pattern of replication.
Introduction: DNA is a type of
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
a. Propose three different mutations to prevent initiation, elongation, and termination of bacterial
DNA replication, respectively. Explain how/why each mutation would prevent its respective step.
(Hint: mutations can be in genes that encode proteins or regulatory DNA sequences)
b. In the early 1900s, Avery, MacLeod, and McCarty performed an experiment in bacterial cells to
determine whether DNA, RNA, or protein functions as the 'transforming molecule' (i.e. the genetic
material). In your own words, how did their experiment (depicted in the figure below) help to
answer that question?
Home Work:
• Suppose you perform a PCR that begins with one double-strand of the
following DNA template:
+5' -СТАССТСCGGGTTGACTGСТАССТТССССGGATGCCCAAAAТТСТСGAG-3—
::::::::::::
:::::::::::: ::::
+3'-GATGGACССССААСТGACGATGGAAGGGCCCТАССGGTTTTAAGAGCTC-5'+
A. Draw one cycle of PCR reaction below the following diagram.
B. Label the template DNA, the primers, and what is happening at each step.
(1)
température
cycle #1
DNA Replication Drawing
Name:
Using penci, you will draw a representation of DNA replication along the leading and lagging strands.
Follow the directions below, drawing each element in its proper location along the replicating DNA
strand. Once you are sure everything is in the correct place, complete your drawing by adding color to
distinguish objects as separate.
1. On the diagram below, label the 5 and 3' onds of both parental DNA strands (you can make up
which is which)
2 Label the replication fork
3. Draw and label helicase
4. Label the overall direction of DNA replication
5. Draw and label single stranded binding proteins
6. Draw and label the leadng strand
7. Draw and label a single DNA polymerase IIl on the leading strand
8. Draw and label an RNA primer on the leading strand
9. Draw and label a DNA polymerase I on the leading strand
10. On the lagging strand, draw and label at least three Okazaki fragments
11. On the lagging strand. draw and label at least two DNA polymerase IIl…
Chapter 21 Solutions
BIOLOGY-TEXT
Ch. 21.1 - Prob. 1CSCh. 21.1 - Prob. 1CCCh. 21.1 - Prob. 2CCCh. 21.1 - Prob. 3CCCh. 21.2 - Prob. 1CCCh. 21.2 - Prob. 2CCCh. 21.2 - Prob. 3CCCh. 21.3 - Prob. 1EQCh. 21.3 - Prob. 2EQCh. 21.3 - Prob. 3EQ
Ch. 21.4 - Prob. 1CCCh. 21.4 - Prob. 1CSCh. 21.5 - Prob. 1CSCh. 21.5 - Repetitive Sequences and Transposable Elements...Ch. 21 - Prob. 1TYCh. 21 - DNA ligase is needed in a cloning experiment a. to...Ch. 21 - Prob. 3TYCh. 21 - Why is Taq polymerase used in PCR rather than...Ch. 21 - Lets suppose you want to clone a gene that has...Ch. 21 - In the CRISPR-Cas technology for editing genes,...Ch. 21 - Prob. 7TYCh. 21 - The enzyme that helps short segments of DNA move...Ch. 21 - Prob. 9TYCh. 21 - Which of the following was not a goal of the Human...Ch. 21 - Prob. 1CQCh. 21 - Briefly describe whether or not each of the...Ch. 21 - Prob. 3CQCh. 21 - Identify and discuss three important advances that...Ch. 21 - Prob. 2COQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Matching Type Choose the directionality of the given process. (4 points) What is the directionality of the given process? * 4 points 3'-5' 5'-3' Exonuclease activity Complementary strand of the continuous strand Addition of nucleotides going to the replication fork Addition of nucleotides away from the replication forkarrow_forwardb. The diagram below is of a short stretch of prokaryotic chromosomal DNA in the process of replication. Please supply the specific pieces of information requested by the boxes below. 1. What enzyme relaxes the supercoils? 2. What enzyme unwinds the DNA? 7. What does this arrow represent? 3. What enzyme synthesizes the RNA primer 8. Why should this single-stranded portion be stabilized? 4. What is this short segment of DNA called? 9. What enzyme synthesizes this long DNA segment? 5. What enzyme removes the RNA primer and replaces it with DNA? 10. Is this the leading or the lagging side? 6. What enzyme joins the short segments of DNA together? 3arrow_forwardplease answer these questions for this image What is the source of the DNA? What is the target? What vector is being used to move the DNA? What is the benefit of transforming the target cell in these ways?arrow_forward
- イト会 Why DNA methylation needed for DNA replication ? * Your answer What is the general way for prolongation of life of organisms ? * Your answer How to design allele specific primers? * Your answer What is the role of non-coding RNAS in DNA replication? * Your answerarrow_forwardTOPIC: PCR and Gene Cloning Basics Question: What are 2 possible roles of CaCl2 in the transformation process?arrow_forwardDescribe your amplicon based on molecular size. Comparing the size of the genomic DNA Describe your amplicon based on molecular size. Comparing the size of the genomic DNA (as seen in Fig. 8.1) and the PCR products based on band position in the gel (as seen in Fig. 8.2).arrow_forward
- several options can be correct Consider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During RNA transcription, this double-strand molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. Please select all the peptide sequence(s) that could be produced from the mRNA transcribed from this segment of DNA. (Hint: you need to use the genetic codon table to translate the determined mRNA sequence into peptide. Please be reminded that there are more than one reading frames.) Question 6 options: ...-Asp-Cys-Gln-Ser-... ...-Leu-Thr-Val-... ...-Thr-Val-Ser-... ...-Leu-Ser-Val-... ...-Met-Asp-Cys-Gln-...arrow_forwardProtein Synthesis and Mutation Practice • Complete the lines below by determining the mRNA transcript and amino acid sequence. • Compare the mutant DNA strands to the wild type strand. ⚫ Circle the mutation in the mutant DNA strands and describe the type of mutation (frameshift - insertion, frameshift - deletion, point - missense, point - silent, or point-nonsense). Not all of these will be used in this assignment! Wild type DNA template: 3' TACGCGTGCACGATGCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Mutation #1 DNA template: 3' TACGCGTGCACGATCCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Type of mutation: Mutation #2 DNA template: 3' TACGCGTGCTCGATGCAGTAGTACATC5' mRNA transcript sequence: Amino acid sequence: Type of mutation:arrow_forwardPractice: DNA Structure and Replication 1. Label each part of the model to the right. Include specific nitrogen base pairs in your labeling. 2. What molecule is it? 3. What is its purpose? 4. Where can it be found in a prokaryotic cell? 5. Where can it be found in a eukaryotic cell? 6. It gets copied during a process called replication. When does this happen? 7. What is the result of DNA replication? 8. Why is DNA replication necessary? 10. What would the chromosome to the right look like after DNA replication? 11. What would the chromosome to the right be called after DNA replication? 9. Why is DNA replication said to be semi-conservative? Draw a picture to support your answer. TAACCGAGTTCAGA b. TTAACCGAGTTCAGA Genetics Unit Sol Sol Dal 12. Replicate the following four DNA strands using what you know about complementary base pairs. TACOTCCAGATITT a. AATACGTCCAGATTTT c. CCCGCGGAATATACA O book It's Not Rocket Science 2016 d. AGGGCTACTTCAGAC J 7arrow_forward
- Correct order ib which the following enzynes would operate to fix a damaged nucleotide in a human gene. a) nuclease, DNA polymerase, RNA primase b) helicase, DNA polymerase, DNA ligase c) DNA ligase, nuclease, helicase d) nuclease, DNA polymerase, DNA ligasearrow_forwardGive 2 advantages of SPACER DNA SEQUENCES as regions in the genome/chromosome totarget for DNA marker development.arrow_forwardThese are written as either accurate or contain errors. Rewrite each one with an error as an accurate statement. Please have an explanation. Thank you! Over time telomeres shorten over time because when the primer is removed at the end of chromosome strand cannot be filled in because there is not free 3’ OH. Semiconservative DNA replication indicates that daughter strands are hybrid molecules with half (one strand being parental) and the other being newly synthesized. A mutation in the gene responsible for transcribing primase would affect only the lagging strand of DNA. In eukaryotes RNA polymerase binds to the activator, specifically at the TATA box to align with the translational start site. Transcription Factors can have more than one function domain. One is the DNA-binding domain and the other is a trans-activation domain. Additive alleles function at one gene to contribute to the phenotype of an organisms, while non-additive alleles at that one gene do not add to the phenotype.…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305389892/9781305389892_smallCoverImage.gif)
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY