General, Organic, and Biological Chemistry
7th Edition
ISBN: 9781285853918
Author: H. Stephen Stoker
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 22, Problem 22.110EP
Interpretation Introduction
Interpretation: The sequence of amino acids coded by the given mRNA sequence has to be stated.
Concept introduction: A three
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Predict the sequence of amino acid coded by the mrna sequence
5’ GGA-GGC-ACA-UGG- GAA 3’
Predict the sequence of amino acids coded by the mRNA sequence 5’ GGA–GGC–ACA–UGG–GAA 3’
Translate the mRNA sequence of HBs
mRNA
5'- AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU -3'
Chapter 22 Solutions
General, Organic, and Biological Chemistry
Ch. 22.1 - Which of the following statements concerning...Ch. 22.1 - Which of the following statements concerning...Ch. 22.2 - Any given nucleotide in a nucleic acid contains a....Ch. 22.2 - How many different sugars and how many different...Ch. 22.2 - How many different heterocyclic bases that are...Ch. 22.3 - Which of the following is present in nucleotides...Ch. 22.3 - Which of the following is an incorrect statement...Ch. 22.3 - How many of the eight nucleic acid nucleotides are...Ch. 22.3 - Prob. 4QQCh. 22.4 - Prob. 1QQ
Ch. 22.4 - The backbone of a nucleic acid molecule involves...Ch. 22.4 - In a segment of a nucleic acid each nonterminal...Ch. 22.4 - Prob. 4QQCh. 22.4 - Prob. 5QQCh. 22.5 - Prob. 1QQCh. 22.5 - Prob. 2QQCh. 22.5 - Fifteen percent of the bases in a certain DNA...Ch. 22.5 - Which of the following is the correct...Ch. 22.6 - Replication of DNA produces two daughter molecules...Ch. 22.6 - In DNA replication the DNA double helix unwinds...Ch. 22.6 - Prob. 3QQCh. 22.6 - In DNA replication the unwinding of the DNA double...Ch. 22.6 - Prob. 5QQCh. 22.7 - Prob. 1QQCh. 22.7 - Prob. 2QQCh. 22.8 - Prob. 1QQCh. 22.8 - The m in the designation mRNA stands for a. mega...Ch. 22.8 - Prob. 3QQCh. 22.8 - Prob. 4QQCh. 22.9 - Prob. 1QQCh. 22.9 - Prob. 2QQCh. 22.9 - Prob. 3QQCh. 22.9 - Prob. 4QQCh. 22.9 - Prob. 5QQCh. 22.10 - Which of the following statements concerning...Ch. 22.10 - Prob. 2QQCh. 22.10 - Prob. 3QQCh. 22.10 - Prob. 4QQCh. 22.11 - Which of the following is an incorrect pairing of...Ch. 22.11 - Prob. 2QQCh. 22.11 - A tRNA molecule with the anticodon 5 AAG 3 will...Ch. 22.12 - Prob. 1QQCh. 22.12 - Which of the following events is not part of the...Ch. 22.12 - The number of codon binding sites in an...Ch. 22.12 - Prob. 4QQCh. 22.12 - Prob. 5QQCh. 22.13 - Which of the following describes the effect of a...Ch. 22.13 - Which of the following describes the effect of a...Ch. 22.13 - Which of the following statements applies to both...Ch. 22.14 - Which of the following statements about a virus is...Ch. 22.14 - Prob. 2QQCh. 22.15 - Prob. 1QQCh. 22.15 - Prob. 2QQCh. 22.15 - The role of E. coli plasmids in obtaining rDNA is...Ch. 22.15 - Prob. 4QQCh. 22.15 - Prob. 5QQCh. 22.16 - Prob. 1QQCh. 22.16 - Each cycle of the polymerase chain reaction a....Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following pentoses is...Ch. 22 - Indicate whether each of the pentoses in Problem...Ch. 22 - With the help of Figure 22-2, identify each of the...Ch. 22 - With the help of Figure 22-2, identify each of the...Ch. 22 - With the help of Figure 22-2, what is the...Ch. 22 - With the help of Figure 22-2, what is the...Ch. 22 - With the help of Figure 22-2, indicate whether...Ch. 22 - With the help of Figure 22-2, indicate whether...Ch. 22 - How many different choices are there for each of...Ch. 22 - How many different choices are there for each of...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - What is the name of the nucleoside that contains...Ch. 22 - What is the name of the nucleoside that contains...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following is a DNA...Ch. 22 - Prob. 22.20EPCh. 22 - Nucleotides containing ribose, thymine, and...Ch. 22 - Prob. 22.22EPCh. 22 - What nitrogen-containing base and what sugar are...Ch. 22 - What nitrogen-containing base and what sugar are...Ch. 22 - What is the name of each of the nucleotides in...Ch. 22 - What is the name of each of the nucleotides in...Ch. 22 - Consider the following nucleotide. a. What is the...Ch. 22 - Consider the following nucleotide. a. What is the...Ch. 22 - Indicate whether each of the following is (1) a...Ch. 22 - Indicate whether each of the following is (1) a...Ch. 22 - For the trinucleotide 5 GCA 3 a. How many...Ch. 22 - For the trinucleotide 5 UCG 3 a. How many...Ch. 22 - Is the trinucleotide in Problem 22-31 found only...Ch. 22 - Is the trinucleotide in Problem 22-32 found only...Ch. 22 - In the lengthening of a polynucleotide chain,...Ch. 22 - In the lengthening of a polynucleotide chain,...Ch. 22 - Draw the structure of the RNA dinucleotide 5 UG 3.Ch. 22 - Draw the structure of the DNA dinucleotide 5 TA 3.Ch. 22 - For the trinucleotide 5 T-G-A 3 a. How many...Ch. 22 - For the trinucleotide 5 U-C-G 3 a. How many...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following are...Ch. 22 - Indicate whether each of the following are...Ch. 22 - The base content of a particular DNA molecule is...Ch. 22 - The base content of a particular DNA molecule is...Ch. 22 - What structural consideration prevents the bases A...Ch. 22 - What structural consideration prevents the bases C...Ch. 22 - The base composition for one of the strands of a...Ch. 22 - The base composition for one of the strands of a...Ch. 22 - Convert each of the following 3-to-5 DNA base...Ch. 22 - Convert each of the following 3-to-5 DNA base...Ch. 22 - Using the concept of complementary base pairing,...Ch. 22 - Using the concept of complementary base pairing,...Ch. 22 - For the DNA segment 5 TTGCAC 3 how many of each of...Ch. 22 - For the DNA segment 5 TAGATG 3 how many of each of...Ch. 22 - What is the base sequence, specified in the 5-to-3...Ch. 22 - What is the base sequence, specified in the 5-to-3...Ch. 22 - In the replication of a DNA molecule, two daughter...Ch. 22 - In the replication of a DNA molecule, two daughter...Ch. 22 - How does the synthesis of a daughter DNA strand...Ch. 22 - Prob. 22.62EPCh. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Prob. 22.65EPCh. 22 - Prob. 22.66EPCh. 22 - Suppose that 28% of the nucleotides in a DNA...Ch. 22 - Suppose that 30% of the nucleotides in a DNA...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Prob. 22.70EPCh. 22 - Prob. 22.71EPCh. 22 - Prob. 22.72EPCh. 22 - Prob. 22.73EPCh. 22 - Prob. 22.74EPCh. 22 - Indicate whether the predominant cellular location...Ch. 22 - Indicate whether the predominant cellular location...Ch. 22 - Indicate whether each of the following situations...Ch. 22 - Indicate whether each of the following processes...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Prob. 22.81EPCh. 22 - Prob. 22.82EPCh. 22 - For each of the following DNA template strands,...Ch. 22 - Prob. 22.84EPCh. 22 - What is the base sequence, specified in the 5-to-3...Ch. 22 - Prob. 22.86EPCh. 22 - Prob. 22.87EPCh. 22 - Prob. 22.88EPCh. 22 - What mRNA base sequence, specified in the 5-to-3...Ch. 22 - Prob. 22.90EPCh. 22 - Prob. 22.91EPCh. 22 - What mRNA base sequence, specified in the 5-to-3...Ch. 22 - Prob. 22.93EPCh. 22 - Prob. 22.94EPCh. 22 - Prob. 22.95EPCh. 22 - An hnRNA molecule contains three exons, with the...Ch. 22 - Prob. 22.97EPCh. 22 - Indicate whether each of the following...Ch. 22 - Prob. 22.99EPCh. 22 - Prob. 22.100EPCh. 22 - Prob. 22.101EPCh. 22 - Prob. 22.102EPCh. 22 - Prob. 22.103EPCh. 22 - Prob. 22.104EPCh. 22 - Explain why the base sequence ATC could not be a...Ch. 22 - Explain why the base sequence AGAC could not be a...Ch. 22 - Predict the sequence of amino acids coded by the...Ch. 22 - Prob. 22.108EPCh. 22 - Prob. 22.109EPCh. 22 - Prob. 22.110EPCh. 22 - Determine each of the following items using the...Ch. 22 - Determine each of the following items using the...Ch. 22 - Prob. 22.113EPCh. 22 - Prob. 22.114EPCh. 22 - Prob. 22.115EPCh. 22 - Prob. 22.116EPCh. 22 - Prob. 22.117EPCh. 22 - Prob. 22.118EPCh. 22 - Prob. 22.119EPCh. 22 - Which amino acid will a tRNA molecule be carrying...Ch. 22 - Prob. 22.121EPCh. 22 - Prob. 22.122EPCh. 22 - Prob. 22.123EPCh. 22 - The following is a base sequence for an exon...Ch. 22 - Indicate whether each of the following statements...Ch. 22 - Prob. 22.126EPCh. 22 - Prob. 22.127EPCh. 22 - Prob. 22.128EPCh. 22 - Prob. 22.129EPCh. 22 - Prob. 22.130EPCh. 22 - Prob. 22.131EPCh. 22 - Prob. 22.132EPCh. 22 - Prob. 22.133EPCh. 22 - Prob. 22.134EPCh. 22 - Consider the following mRNA base sequence 5CUUCAG3...Ch. 22 - Consider the following mRNA base sequence 5ACCCAC3...Ch. 22 - Consider the following DNA base sequence 3TTAATA5...Ch. 22 - Consider the following DNA base sequence 3TATCGG5...Ch. 22 - The DNA template strand segment 3TTCAAACCGTAC5...Ch. 22 - Prob. 22.140EPCh. 22 - Prob. 22.141EPCh. 22 - Prob. 22.142EPCh. 22 - Prob. 22.143EPCh. 22 - Prob. 22.144EPCh. 22 - Prob. 22.145EPCh. 22 - Prob. 22.146EPCh. 22 - Prob. 22.147EPCh. 22 - Prob. 22.148EPCh. 22 - Prob. 22.149EPCh. 22 - Prob. 22.150EPCh. 22 - Prob. 22.151EPCh. 22 - Prob. 22.152EPCh. 22 - Prob. 22.153EPCh. 22 - Prob. 22.154EP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, chemistry and related others by exploring similar questions and additional content below.Similar questions
- Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?arrow_forwardGiven the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?arrow_forwardAn unprocessed pre-mRNA has the following structure. Which of the following is not a possible size (in bp) of the mature mRNA? 205bp 180bp 150bp 100bparrow_forward
- Given the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the stop codon, the untranslated regions and predict the amino acid sequence of the polypeptidarrow_forwardWrite down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAGarrow_forwardDerive the amino acid sequence that is coded for by the following mRNA sequence. 5' CAU AAA ACG GUG UUA AUA 3'arrow_forward
- Explain The mRNA codon of valine is: GUC UGG CCA TTGarrow_forwardDuring transcription, a portion of mRNA is synthesized with the following base sequence. 5'-AUG-GUA-CCA-CAU-UUG-UGA-3' Q.) Write the primary structure of the polypeptide coded for by this section of mRNA.arrow_forwardDetermine the amino acid sequence for a polypeptide coded for by the following mRNA transcript (written 5'-> 3'): AUGCCUGACUUUAAGUAGarrow_forward
- For the codon sequence : 5’ GGA – AUA – UGG – UUC – CUA – 3’ Write the Amino acid sequence produced in each of the following ways: Translation proceeds in a normal manner A mutation changes GGA to GGG A mutation changes GGA to CGAarrow_forwardFor the following mRNA sequence (reading from left to right) what will be the amino acid sequence following translation? (Use chart provided) AUGCCAGUUGAAUAA A. Pro-Val-Met-Leu-His B. Met-Val-Tyr-Pro C. Met-Pro-Val-Glu D. Correct answer not given E. Met-His-Phe-Ala-Argarrow_forwardAn mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781337408332
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Nucleic acids - DNA and RNA structure; Author: MEDSimplified;https://www.youtube.com/watch?v=0lZRAShqft0;License: Standard YouTube License, CC-BY