Concept explainers
(a)
Interpretation: The base sequence of informational DNA strand and hnRNA for the DNA template strand
Concept introduction: DNA strand contains a complementary base pairing between A-T and C-G. The complementary strands are antiparallel to each other. RNA molecule contains the similar base pairing but the base thymine is replaced by uracil.
(b)
Interpretation: The base sequence of informational DNA strand and hnRNA for the DNA template strand
Concept introduction: DNA strand contains a complementary base pairing between A-T and C-G. The complementary strands are antiparallel to each other. RNA molecule contains the similar base pairing but the base thymine is replaced by uracil.
(c)
Interpretation: The base sequence of informational DNA strand and hnRNA for the DNA template strand
Concept introduction: DNA strand contains a complementary base pairing between A-T and C-G. The complementary strands are antiparallel to each other. RNA molecule contains the similar base pairing but the base thymine is replaced by uracil.
(d)
Interpretation: The base sequence of informational DNA strand and hnRNA for the DNA template strand
Concept introduction: DNA strand contains a complementary base pairing between A-T and C-G. The complementary strands are antiparallel to each other. RNA molecule contains the similar base pairing but the base thymine is replaced by uracil.
Want to see the full answer?
Check out a sample textbook solutionChapter 22 Solutions
Bundle: General, Organic, and Biological Chemistry, 7th + OWLv2 Quick Prep for General Chemistry, 4 terms (24 months) Printed Access Card
- a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =arrow_forwardThe template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?arrow_forwardBelow is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…arrow_forward
- which of the following sequences would most likely be able to bind a cyclic amp dna binding protein? (only one strand is shown but assume dna is double stranded) a. 5' atagtcatagtc 3' b. 5' atcggtctcgat 3' c. 5' gctctagcgagc 3' d. 5' atagtaatgata 3'arrow_forwardThe following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?arrow_forwardAnswer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.arrow_forward
- a. This piece of DNA is cut by EcoRI, the resulting fragments are separated by gel electrophoresis, and the gel is stained with ethidium bromide. Draw a picture of the bands that will appear on the gel. b. If a mutation that alters EcoRI site 1 occurs in this piece of DNA, how will the banding pattern on the gel differ from the one that you drew in part a? c. If mutations that alter EcoRI sites 1 and 2 occur in this piece of DNA, how will the banding pattern on the gel differ from the one that you drew in part a? d. If 1000 bp of DNA were inserted between the two restriction sites, how would the banding pattern on the gel differ from the one that you drew in part a? e. If 500 bp of DNA between the two restriction sites were deleted, how would the banding pattern on the gel differ from the one that you drew in part a?arrow_forwarda) Complete the table below. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. Label the 5’ and 3’ ends of DNA and RNA and carboxy and amino acid ends of protein. (You may fill in this chart by hand writing- no typing necessary here.) 2. b) Is the top or bottom DNA strand the template strand?arrow_forwardConsider the following sequence of DNA: 3'-TTA CGG-5'What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?arrow_forward
- In the following figure, provide RNA sequence of Gene a and Gene b in a 5'-3' direction. Provide the DNA sequence of Gene c on the non-template strand. 4. Genes a and c are transcribed from the bot strand,... RNA DNA 5' 3 Gene a GGACCTA Gene b Gene c 3' 5' ACGTCAG RNA RNA UUAGAUC ...and b is transcribed from the top strand.arrow_forwardRefer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?arrow_forwardGiven the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education