PRESCOTT'S MICROBIOLOGY
PRESCOTT'S MICROBIOLOGY
11th Edition
ISBN: 2818440045677
Author: WILLEY
Publisher: MCG
bartleby

Videos

Question
Book Icon
Chapter 23, Problem 3AL
Summary Introduction

The genus Streptomyces is classified under the order of Streptomycetales. Chains of spores (3 to 50) or even more exospores are produced by these bacteria. These bacteria are of high importance in medicine because they produce antibiotics, antifungal and anticancer agents.

Blurred answer
Students have asked these similar questions
Please explain how alternative gene expression is mediated by a recombination process in Salmonella? Please explain why does Salmonella use recombination-mediated alternative gene expression?
Imagine you are going to label a gene associated with apoptosis in Symbiodiniaceae with a Yellow Fluorescent Protein (YFP). To generate the YFP, you know the pre-MRNA looks as follows: Unspliced YFP premature mRNA Сap 5' UTR Exon 1 Intron Exon 2 Intron Exon 3 3' UTR Poly-A tail If Exon 2 is also required for mRNA stability, what can be predicted from the possible spliced alternative isoforms formed? One of the isoforms will not have a poly-A tail O The alternative splicing of YFP pre-MRNA prevents 5'-capping The MRNA isoform without Exon 2 will be degraded faster than the other isoform Exon 2 will be added to isoform B later to correct the mistake in splicing The protein translated from one of the mRNA isoforms will possess an additional functional domain
Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'

Chapter 23 Solutions

PRESCOTT'S MICROBIOLOGY

Ch. 23.1 - Prob. 1.8CCCh. 23.1 - Retrieve, Infer, Apply List the distinguishing...Ch. 23.1 - Prob. 2.2CCCh. 23.1 - Prob. 2.3CCCh. 23.1 - Retrieve, Infer, Apply Describe three ways in...Ch. 23.1 - Briefly describe the defining properties of genera...Ch. 23.1 - Prob. 2.6CCCh. 23.1 - Examine the ingredients list on a commercial...Ch. 23.2 - What growth or survival advantage might this type...Ch. 23.2 - What is the net yield of ATP for each glucose that...Ch. 23.2 - Prob. 3MICh. 23.2 - Prob. 1CCCh. 23.2 - Prob. 2CCCh. 23.2 - Prob. 3CCCh. 23.2 - Prob. 4CCCh. 23.2 - How are various species of Streptococcus...Ch. 23.2 - Of what practical importance are leuconostocs?...Ch. 23.2 - What is the difference between -hemolysis and...Ch. 23.3 - The presence of an electron transport chain in a...Ch. 23.3 - In addition to its Gram-staining characteristics,...Ch. 23.3 - What are the two sources of electrons for the H....Ch. 23.4 - Prob. 1CCCh. 23.4 - Suggest why C. tetani uses a sodium motive force...Ch. 23.4 - Prob. 3CCCh. 23.4 - What kind of genetic evidence, in addition to 16S...Ch. 23 - Prob. 1RCCh. 23 - Prob. 2RCCh. 23 - Prob. 3RCCh. 23 - Prob. 4RCCh. 23 - Prob. 5RCCh. 23 - Prob. 6RCCh. 23 - Prob. 7RCCh. 23 - Prob. 8RCCh. 23 - Prob. 9RCCh. 23 - Prob. 10RCCh. 23 - Even though actinobacteria are high G + C...Ch. 23 - Given that mycolic acids are essential for...Ch. 23 - Prob. 3ALCh. 23 - Prob. 4ALCh. 23 - Prob. 5ALCh. 23 - What physiological properties might account for...Ch. 23 - S. aureus strains that are resistant to...Ch. 23 - Prob. 8AL
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Cell Differentiation | Genetics | Biology | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=gwAz_BtVuLA;License: Standard YouTube License, CC-BY