PRESCOTT'S MICROBIOLOGY
11th Edition
ISBN: 2818440045677
Author: WILLEY
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Question
Chapter 23, Problem 3AL
Summary Introduction
The genus Streptomyces is classified under the order of Streptomycetales. Chains of spores (3 to 50) or even more exospores are produced by these bacteria. These bacteria are of high importance in medicine because they produce antibiotics, antifungal and anticancer agents.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Please explain how alternative gene expression is mediated by a recombination process in Salmonella? Please explain why does Salmonella use recombination-mediated alternative gene expression?
Imagine you are going to label a gene associated with apoptosis in
Symbiodiniaceae with a Yellow Fluorescent Protein (YFP). To
generate the YFP, you know the pre-MRNA looks as follows:
Unspliced YFP premature mRNA
Сap
5' UTR
Exon 1
Intron
Exon 2
Intron
Exon 3
3' UTR
Poly-A tail
If Exon 2 is also required for mRNA stability, what can be predicted
from the possible spliced alternative isoforms formed?
One of the isoforms will not have a poly-A tail
O The alternative splicing of YFP pre-MRNA prevents 5'-capping
The MRNA isoform without Exon 2 will be degraded faster than the other
isoform
Exon 2 will be added to isoform B later to correct the mistake in splicing
The protein translated from one of the mRNA isoforms will possess an
additional functional domain
Explain the function of spliceosomes in eukaryotic cells.
The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and
spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the
sequence of the mature MRNA after splicing? [
5' AUGGGUUUAGGACCCCCGAUAAA 3'
Chapter 23 Solutions
PRESCOTT'S MICROBIOLOGY
Ch. 23.1 - MICRO INQUIRY Refer to table 24.2 and determine...Ch. 23.1 - MICRO INQUIRY Why do Mycobacterium spp. have...Ch. 23.1 - Prob. 3MICh. 23.1 - Prob. 1.1CCCh. 23.1 - Prob. 1.2CCCh. 23.1 - Retrieve, Infer, Apply Why are actinobacteria of...Ch. 23.1 - Prob. 1.4CCCh. 23.1 - Retrieve, Infer, Apply Compare the morphology and...Ch. 23.1 - Prob. 1.6CCCh. 23.1 - Prob. 1.7CC
Ch. 23.1 - Prob. 1.8CCCh. 23.1 - Retrieve, Infer, Apply List the distinguishing...Ch. 23.1 - Prob. 2.2CCCh. 23.1 - Prob. 2.3CCCh. 23.1 - Retrieve, Infer, Apply Describe three ways in...Ch. 23.1 - Briefly describe the defining properties of genera...Ch. 23.1 - Prob. 2.6CCCh. 23.1 - Examine the ingredients list on a commercial...Ch. 23.2 - What growth or survival advantage might this type...Ch. 23.2 - What is the net yield of ATP for each glucose that...Ch. 23.2 - Prob. 3MICh. 23.2 - Prob. 1CCCh. 23.2 - Prob. 2CCCh. 23.2 - Prob. 3CCCh. 23.2 - Prob. 4CCCh. 23.2 - How are various species of Streptococcus...Ch. 23.2 - Of what practical importance are leuconostocs?...Ch. 23.2 - What is the difference between -hemolysis and...Ch. 23.3 - The presence of an electron transport chain in a...Ch. 23.3 - In addition to its Gram-staining characteristics,...Ch. 23.3 - What are the two sources of electrons for the H....Ch. 23.4 - Prob. 1CCCh. 23.4 - Suggest why C. tetani uses a sodium motive force...Ch. 23.4 - Prob. 3CCCh. 23.4 - What kind of genetic evidence, in addition to 16S...Ch. 23 - Prob. 1RCCh. 23 - Prob. 2RCCh. 23 - Prob. 3RCCh. 23 - Prob. 4RCCh. 23 - Prob. 5RCCh. 23 - Prob. 6RCCh. 23 - Prob. 7RCCh. 23 - Prob. 8RCCh. 23 - Prob. 9RCCh. 23 - Prob. 10RCCh. 23 - Even though actinobacteria are high G + C...Ch. 23 - Given that mycolic acids are essential for...Ch. 23 - Prob. 3ALCh. 23 - Prob. 4ALCh. 23 - Prob. 5ALCh. 23 - What physiological properties might account for...Ch. 23 - S. aureus strains that are resistant to...Ch. 23 - Prob. 8AL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Briefly describe how a phosphorelay system and sigma factors are used to control sporulation in B. subtilis. Give one example of posttranslational modification as a means to regulate this process.arrow_forwardRepressors are inactivated either by interaction with a small-molecule inducer or by proteolytic cleavage. Why is it advantageous for a repressor like the lac repressor to be inactivated by binding to allolactose rather than by proteolytic cleavage?arrow_forwardYou are working in a lab studying Progeria. You design an expression vector containing a mutated form of the lamin gene that codes for a lamin protein that can no longer be phosphorylated. What do you predict would happen if you express this mutant form of lamin in a cell line? Lamin proteins would not be transported into the nucleus and would remain in the cytosol. Nuclear lamins will be unable to produce dimers, as the coiled-coil formation will be disrupted. Disassembly of the nuclear lamins will occur prematurely. Nuclear lamins will no longer disassemble properly during prometaphase. O Nuclear lamins will no longer assemble properly during telophase.arrow_forward
- Three different chitin synthase genes control chitin synthesis in S. cerevisiae. Discuss what will happen to the budding yeast if a mutation occurs in each of the genes below: CHSI CHSII CHSIIIarrow_forwardA gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arq- tyr. A mutation in this gene has a G inserted after the second C in the strand. How will this mutation affect the phenotype? A)This will affect the phenotype because although most of the protein will be identical, the first amino acid will be different. B)This will not affect the phenotype because only the second amino acid is different from the original protein. C)This will not affect the phenotype because the protein will be identical to the original protein. D)This will affect the phenotype because all of the amino acids after the first one will be different from the original protein.arrow_forwardA full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete promoter sequence and a functional polyadenylation sequence, and it has wild-type nucleotides throughout the transcribed region. However, the gene fails to produce a functional protein. a)List at least 3 possible reasons why this eukaryotic gene is not expressed in bacteria. b)What changes would you recommend to permit expression of this eukaryotic gene in a bacterial cell?arrow_forward
- Describe how one might determine which proteins in E.coli are repressed when a culture is shifted from a minimal medium to a rich medium containing many amino acids, bases and vitamins. How might one study which genes are expressed during each growth condition?arrow_forwardThe figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature mRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides.arrow_forwardThe figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature mRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides. 99 62 120 84 102 27 117 Gene X E1 11 E2 12 ЕЗ 13 E4 Exon (E) Intron (I)arrow_forward
- M13 is a filamentous phage that infects the bacterium Escherichia coli. Infection with M13 is not lethal. However, the infection causes turbid plaques in E. coli because infected bacteria grow slower than the surrounding uninfected bacteria. This phage has been engineered to act as a vector system. Explain how the amplification of gene of interest works in this phage with illustration.arrow_forwardThe figure below shows the introns and exons found in gene X. The size of each exon and intron is shown as well. A study on this organism found that two mature MRNA molecules are produced for this gene. One is 457 nucleotides in length, and the other is 439 nucleotides in length. Name the process responsible for producing this variation. Also explain how these 457 and 439 nucleotide fragments were produced by referring to the information provided. Hint: This organism produces a poly-A tail of 120 nucleotides. 99 62 120 84 102 27 117 Gene X E1 в в 11 E2 12 E4 Exon (E) Intron (1)arrow_forwardGene X codes for a protein in eukaryotes. A mutated eukaryotic cell contains an altered base-pair in an intron of gene X. Which would be the most likely effect of this mutation on the biomolecules in the cell? The amount of pre-mRNA transcribed from gene X would be less than normal. The amount of functional protein corresponding to gene X would be less than normal. The ability of snRNAs to form a spliceosome would be diminished. The breakdown of mature mRNA corresponding to gene X would be fasterarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Cell Differentiation | Genetics | Biology | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=gwAz_BtVuLA;License: Standard YouTube License, CC-BY