Concept explainers
(a)
To determine: The reason that a recA protein mutation in Escherichia coli make it a better host for the propagation of recombinant plasmid DNA (Deoxyribose
Introduction: Restriction endonucleases which are also called molecular scissors are the enzymes that are used in molecular biology for the formation of the recombinant molecule. Plasmid vectors act as the carriers of foreign information that has to be incorporated into a recombinant molecule.
(b)
To determine: The reason that mutations in restriction endonucleases of Escherichia coli are useful.
Introduction: Restriction endonucleases which are also called molecular scissors are the enzymes that are used in molecular biology for the formation of the recombinant molecule. Plasmid vectors act as the carriers of foreign information that has to be incorporated into a recombinant molecule.
Want to see the full answer?
Check out a sample textbook solutionChapter 25 Solutions
WORLD OF CELL+MASTERING ACCESS >CUSTOM
- Replication:- what other enzymes are involved in the initiation phase?- explain the role of primers in this phase- how is the building of the leading strand different from that of the lagging strand?arrow_forwardCentral Dogma of Molecular Biology from DNA to RNA to Protein, discussing the principles underlying the transfer of information in a biologic system and its regulation. However, recent research seems to challenge certain aspects of Crick’s Central Dogma. Does the Central Dogma still stand today? If not, can you find an example for a type of information transfer that is not explicitly covered by the Central Dogma (or even violates it)?arrow_forwardTrue or false? DNA repair mechanisms all depend on the existence of two copies of the genetic information, one in each of the homologous chromosomes. DNA primase makes DNA primers for the synthesis of Okazaki fragments in the DNA lagging strand. The repair of double-stranded breaks by nonhomologous end joining is accurate. RNA polymerase III transcribes all protein-coding genes.arrow_forward
- signal transduction- yeast genetics In one sentence, what is the URA3- to URA3+ conversion with plasmid transformation? Why is it necessary to do this first?arrow_forwardPreparing plasmid DNA (double stranded, circular) for Sanger sequencing involves annealing a complementary, single-stranded oligonucleotide DNA primer to one strand of the plasmid template. This is routinely accomplished by heating the plasmid DNA and primer to 90°C and then slowly bringing the temperature down to 25°C. Why does this protocol work? What enzyme is used and what other components are required in the sequencing reaction? How does the Sanger method determine the sequence?arrow_forwardCloned Libraries You are running a PCR to generate copies of a fragment of the cystic fibrosis (CF) gene. Beginning with two copies at the start, how much of an amplification of this fragment will be present after six cycles in the PCR machine?arrow_forward
- RNA polymerase from E. coli (core enzyme alone) has all of the following properties except: a)requires all four ribonucleoside triphosphates and a DNA template. b)can extend an RNA chain and initiate a new chain. c)recognizes specific start signals in DNA. d)produces an RNA polymer that begins with a 5'-triphosphate. e)is required for the synthesis of mRNA, rRNA, and tRNA in E. coli.arrow_forwardgene cloning of amplified gene with enzmesarrow_forwardINSTRUCTION: Given the DNA sequence below, provide the answers to the following items. a. complimentary DNA strand 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C b. mRNA 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C c. protein synthesized 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A Carrow_forward
- Quick help Only cell biology Which process is described in the following paragraph? During DNA synthesis, before the enzyme adds the next nucleotide to a growing DNA strand, it checks whether the previously added nucleotide is correctly base-paired to the template strand. If so, the polymerase adds the next nucleotide; if not, the polymerase clips off the mispaired nucleotide and tries again. This is carried out by cleaving the phosphodiester backbone using the enzyme’s 3’-to-5’ exonuclease activity.arrow_forwardGenetic application problem A couple in which the woman belongs to group 0 Rh- and the man is AB Rh + claim as theirs a baby whose blood is A Rh +. What would you think as a judge about this lawsuit? Explain...arrow_forwarda. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning