Concept explainers
(a)
To determine: A model which explains the functioning of RecBCD enzyme complex at the time of genetic recombination of bacteria.
Introduction: Bacterial cells undergo the process of genetic recombination to exchange their genetic material by different types of pathways. These pathways require RecA protein in different sets in all these pathways for catalyzing strand invasion.
(b)
To determine: The modified model that explains about the co-infection of bacterial cells and mutated bacteria with two different strains of bacteriophage in which genes recombine at a different level of frequencies near their CHI sites.
Introduction: Bacterial cells undergo the process of genetic recombination to exchange their genetic material by different types of pathways. These pathways require RecA protein in different sets in all these pathways for catalyzing strand invasion.
Want to see the full answer?
Check out a sample textbook solutionChapter 25 Solutions
WORLD OF CELL+MASTERING ACCESS >CUSTOM
- Number of Okazaki Fragments in E. coli and Human DNA Replication Approximately how many Okazaki fragments are synthesized in the course of replicating an E. coli chromosome? How many in replicating an “average� human chromosome?arrow_forwardGenetic application problem A couple in which the woman belongs to group 0 Rh- and the man is AB Rh + claim as theirs a baby whose blood is A Rh +. What would you think as a judge about this lawsuit? Explain...arrow_forwardQuestion:- Arrange the following organisms, in terms of percentage of their genes that are alternatively spliced, from highest to lowest. brewer's yeast streptococcus pyogenes gorillas cricketsarrow_forward
- Genome Assembly with Perfect Coverage and Repeats Given a list of error-free DNA 3-mers taken from the same strand of a circular chromosome. Find all circular strings assembled by complete cycles in the de Bruijn graph B2. Find the circular chromosome sequence. Dataset: ATC ATG CAT CCA GAT GGA TCC TGGarrow_forwardTransformation and sequence validation of the clonesarrow_forwarda. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =arrow_forward
- a. Draw roughly the comparative electrophoretic mobilities of close circular DNA, open circular DNA and super coiled DNA, all having the same molecular weight. Why is the separation possible given that all the DNAs (in (a)) have the same molecular weight?arrow_forwardTrue or False? While transposons need to move to reproduce and to distribute to new hosts, the process of transposition inevitably jeopardizes the host organism. True or False? Most transposons prefer DNA targets that are straight. True or False? Mammalian genomes such as the human genome have hundreds of thousands of LINEs, although fewer than 100 of these elements are thought to function autonomously.arrow_forwardCalculating human genome If 1.5 percent of the human genome consists of protein-coding sequences, and the entire genome has 3.2x10^9, how many codons are there in the human genome? Remember that a codon is three nucleotides in length.arrow_forward
- Multiple Replication Forks in E. coli I Assuming DNA replication proceeds at a rate of 750 base pairs per second, calculate how long it will take to replicate the entire E. coli genome. Under optimal conditions, E. coli cells divide every 20 minutes. What is the minimal number of replication forks per E. coli chromosome in order to sustain such a rate of cell division?arrow_forwardTrue or False? Chromatin remodeling involves addition or removal of chemical groups to histones, which alters its binding affinity to DNA and influences whether the promoter region is available for RNApol to bind.arrow_forwardsignal transduction- yeast genetics In one sentence, what is the URA3- to URA3+ conversion with plasmid transformation? Why is it necessary to do this first?arrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning