Concept explainers
(a)
Interpretation:
The RNA sequence code for four amino acids has to be predicted.
Concept Introduction:
Composition of
RNA synthesis: The process of RNA synthesis is Transcription. A small section of DNA unwinds, only one of the two strands act as template and the other strand as informational strand. The complementary bases are attached one by one by the action of RNA polymerase at template strand on moving down. The newly generated RNA is the exact copy of the informational strand, with the exception that a U replaces each T in the template DNA. The RNA synthesised carries genetic information and directs protein synthesis.
Replication of DNA: The process by which copies of DNA are made when a cell divides.
DNA informational strand: 5’ ATG CCA GTA GGC CAC TTG TCA 3’
DNA Template strand: 3’ TAC GGT CAT CCG GTG AAC AGT 5’
mRNA: 5’ AUG CCA GUA GGC CAC UUG UCA 3’
(b)
Interpretation:
The double-stranded DNA sequence code for four amino acids has to be predicted.
Concept Introduction:
Composition of nucleic acid: Nucleic acid is a polymer of nucleotides. Each nucleotide has three parts: a sugar, a nitrogenous base, and a phosphate group. Two nucleotides are joined by phosphate diester linkage where a free phosphate on 5’ carbon of one nucleotide and a free –OH group on 3’ carbon of another nucleotide is linked.
Replication of DNA: The process by which copies of DNA are made when a cell divides.
RNA synthesis: The process of RNA synthesis is Transcription. A small section of DNA unwinds, only one of the two strands act as template and the other strand as informational strand. The complementary bases are attached one by one by the action of RNA polymerase at template strand on moving down. The newly generated RNA is the exact copy of the informational strand, with the exception that a U replaces each T in the template DNA. The RNA synthesised carries genetic information and directs protein synthesis.
DNA informational strand: 5’ ATG CCA GTA GGC CAC TTG TCA 3’
DNA Template strand: 3’ TAC GGT CAT CCG GTG AAC AGT 5’
mRNA: 5’ AUG CCA GUA GGC CAC UUG UCA 3’
protein: Met Pro Val Gly His Leu Ser
(c)
Interpretation:
The template strand and informational strand of DNA has to be accounted.
Concept Introduction:
Composition of nucleic acid: Nucleic acid is a polymer of nucleotides. Each nucleotide has three parts: a sugar, a nitrogenous base, and a phosphate group. Two nucleotides are joined by phosphate diester linkage where a free phosphate on 5’ carbon of one nucleotide and a free –OH group on 3’ carbon of another nucleotide is linked.
RNA synthesis: The process of RNA synthesis is Transcription. A small section of DNA unwinds, only one of the two strands act as template and the other strand as informational strand. The complementary bases are attached one by one by the action of RNA polymerase at template strand on moving down. The newly generated RNA is the exact copy of the informational strand, with the exception that a U replaces each T in the template DNA. The RNA synthesised carries genetic information and directs protein synthesis.
Replication of DNA: The process by which copies of DNA are made when a cell divides.
DNA informational strand: 5’ ATG CCA GTA GGC CAC TTG TCA 3’
DNA Template strand: 3’ TAC GGT CAT CCG GTG AAC AGT 5’
mRNA: 5’ AUG CCA GUA GGC CAC UUG UCA 3’
(d)
Interpretation:
Possible DNA sequence has to be mentioned.
Concept Introduction:
Composition of nucleic acid: Nucleic acid is a polymer of nucleotides. Each nucleotide has three parts: a sugar, a nitrogenous base, and a phosphate group. Two nucleotides are joined by phosphate diester linkage where a free phosphate on 5’ carbon of one nucleotide and a free –OH group on 3’ carbon of another nucleotide is linked.
RNA synthesis: The process of RNA synthesis is Transcription. A small section of DNA unwinds, only one of the two strands act as template and the other strand as informational strand. The complementary bases are attached one by one by the action of RNA polymerase at template strand on moving down. The newly generated RNA is the exact copy of the informational strand, with the exception that a U replaces each T in the template DNA. The RNA synthesised carries genetic information and directs protein synthesis.
Replication of DNA: The process by which copies of DNA are made when a cell divides.
DNA informational strand: 5’ ATG CCA GTA GGC CAC TTG TCA 3’
DNA Template strand: 3’ TAC GGT CAT CCG GTG AAC AGT 5’
mRNA: 5’ AUG CCA GUA GGC CAC UUG UCA 3’
Want to see the full answer?
Check out a sample textbook solutionChapter 26 Solutions
FUND.OF GENERAL,ORG.+BIO.CHEM.(LL)-PKG
- Amino acids have an average molar mass of 100 g/mol.How many bases on a single strand of DNA are needed to codefor a protein with a molar mass of 5x10^5g/mol?arrow_forwardInsulin is synthesized as preproinsulin, which has 81 amino acids. How many heterocyclic bases must be present in the informational DNA strand to code for preproinsulin (assuming no introns are present)?arrow_forwardDraw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphatearrow_forward
- Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?arrow_forwardThe infectious prion protein which are believed to cause a neurodegenerative disease by acting as a template to misfold other cellular prion proteins are usually β-helices. Is this correct or not?arrow_forwardusing, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error on the amino acid chain?arrow_forward
- If a polyribonucleotide contains equal amounts ofrandomly positioned adenine and uracil bases, what proportion of its triplets will encode (a) phenylalanine, (b)isoleucine, (c) leucine, (d) tyrosine?arrow_forwardIn the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'arrow_forwardWhat is the net charge on this peptide from the given DNA sequence?arrow_forward
- Why do you think the motif of the DNA-binding protein shown is called a zinc-finger motif?arrow_forwardFor the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'arrow_forwardA duplex DNA molecule contains a random sequence of the four nucleotides with equal proportions of each. What is the average spacing between consecutive occurrences of the sequence 5'-ATGC-3'? Between consecutive occurrences of the sequence 5'-TACGGC-3'?arrow_forward
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON