Concept explainers
Interpretation:
To code for preproinsulin, the number of heterocyclic bases present in the informational DNA strand has to be predicted.
Concept Introduction:
RNA synthesis: The process of RNA synthesis is Transcription. A small section of DNA unwinds, only one of the two strands act as template and the other strand as informational strand. The complementary bases are attached one by one by the action of RNA polymerase at template strand on moving down. The newly generated RNA is the exact copy of the informational strand, with the exception that a U replaces each T in the template DNA. The RNA synthesised carries genetic information and directs protein synthesis.
Codon: A sequence of three ribonucleotides in the mRNA chain that codes for a specific amino acid; also a three-
Nucleic acid: A complex organic substance present in living cell, which is a long polynucleotides. RNA and DNA are the two types of
Genetic code: The sequence of nucleotides, coded in triplets (codons) in mRNA that determines the sequence of amino acids in protein synthesis.
Want to see the full answer?
Check out a sample textbook solutionChapter 26 Solutions
EP FUND.OF GENERAL,ORG...-MOD.MASTERING
- What factors account for the high phosphoryl-transfer potential of nucleoside triphosphates?arrow_forwardList all possible codons present in a ribonucleotide polymer containing U and G in random sequence. Which amino acids are encoded by this RNA?arrow_forwardWhat is the significance of the pentose monophosphate shunt to synthesis of nucleotides? What is a difference between synthesis of purine and pyrimidine nucleotides?arrow_forward
- The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?arrow_forwardAn exonuclease is an enzyme that sequentially cleaves nucleotides from the end of a polynucleotide strand. Snake venom phosphodiesterase, which hydrolyzes nucleotides from the 3′ end of any oligonucleotidewith a free 3′-hydroxyl group, cleaves between the 3′ hydroxyl of the ribose or deoxyribose and the phosphoryl group of the next nucleotide. It acts on single-stranded DNA or RNA and has no base specificity. This enzyme was used in sequence determination experiments before the development of modern nucleic acid sequencing techniques. What are theproducts of partial digestion by snake venom phosphodiesterase of an oligonucleotide with the sequence (5′)GCGCCAUUGC(3′)—OH?arrow_forwardComplete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acidarrow_forward
- As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardCystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?arrow_forwardHow does the cell ensure that a specific amino acid (say, valine) attaches itself only to the one tRNA molecule that is specific for valine? (A) Proteins called aminoacyl DNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct DNA molecules carrying the right anticodon. (B) Lipids called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The lipid binds the amino acid and one of the correct tRNA molecules carrying the right codon. (C) Enzymes called aminoacyl tRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct tRNA molecules carrying the right anticodon. (D) Enzymes called peptidyl mRNA synthetases are responsible for bringing together the proper pair. The enzymes match the amino acid and one of the correct mRNA molecules carrying the right anticodon.arrow_forward
- A normal polypeptide and a mutant of the polypeptide were hydrolyzed by an endopeptidase under the same conditions. The normal and mutantpolypeptide differ by one amino acid. The fingerprints of the peptides obtained from the two polypeptides are shown below. What kind of amino acid substitution occurred as a result of the mutation? (That is, is the substituted amino acid more or less polar than the original amino acid? Is its pI lower or higher?) (Hint: Photocopy the fingerprints, cut them out, and overlay them.)arrow_forwardWhat is the methyl group-containing nucleobase composition of a double- stranded eukaryotic DNA with 52,000 bases that contains 22% bicyclic nucleobases characterized to have both an amino group and a keto group? (Instructions: Do NOT put spaces or commas or additional words/letters/units; Type in your answer in NUMERICAL FORM with the following format: 1234567)arrow_forwardUsing the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning