Concept explainers
To determine: The sequences of the mature RNA.
Concept introduction: The sequence of the three mRNA
Given: The sequence of the sense strand of a mammalian gene is as follows:
TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATTAATTAAGCACAGGCATGCAGGGATATCCTCCAAAAAGGTAAGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATAAACGATATCGATCGGTTAGGTAAGTCTGAT
Assume that: The transcription initiates at a G, which is approximately 25bp downstream of the TATAATA sequence, in which each 5′ splice site has the sequence AG/GUAAGU, and that each 3′ splice site has the sequence CAG/G, where / marks the location of the splice.
To determine: The sequences of encoded protein.
Concept introduction: The sequence of the three mRNA nucleotides that codes for the amino acids during the translation process is called codon. Three nucleotides constitute a codon that codes for the single amino acid. The codon where the translation process initiates is the start codon, which is usually AUG that codes for methionine. The stop codon terminates the translation process. The stop codons are UAA, UGA, and UAG.
Given: The sequence of the sense strand of a mammalian gene is as follows:
TATAATACGCGCAATACAATCTACAGCTTCGCGTAAATCGTAGGTAAGTTGTAATAAATATAAGTGAGTATGATACAGGCTTTGGACCGATAGATGCGACCCTGGAGGTAAGTATAGATTAATTAAGCACAGGCATGCAGGGATATCCTCCAAAAAGGTAAGTAACCTTACGGTCAATTAATTCAGGCAGTAGATGAATAAACGATATCGATCGGTTAGGTAAGTCTGAT
Assume that: The transcription initiates at a G, which is approximately 25bp downstream of the TATAATA sequence, in which each 5′ splice site has the sequence AG/GUAAGU, and that each 3′ splice site has the sequence CAG/G, where / marks the location of the splice.
![Check Mark](/static/check-mark.png)
Trending nowThis is a popular solution!
![Blurred answer](/static/blurred-answer.jpg)
Chapter 27 Solutions
FUNDAMENTALS OF BIOCHEMISTRY-ACCESS
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781319114671/9781319114671_smallCoverImage.jpg)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781464126116/9781464126116_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781118918401/9781118918401_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134015187/9780134015187_smallCoverImage.gif)