![Pearson eText Fundamentals of General, Organic, and Biological Chemistry -- Instant Access (Pearson+)](https://www.bartleby.com/isbn_cover_images/9780135213759/9780135213759_largeCoverImage.gif)
Concept explainers
Interpretation:
The severity of DNA mutation that produced in the following changes in mRNA codons has to be compared.
Concept Introduction:
Mutation: Mutation is the error occurred in the base sequence of a DNA which is passed along when
Codons are the sequence of three bases in mRNA that specifies the amino acid to be incorporated into a protein.
Some amino acids and their corresponding mRNA codons are listed below,
Start codon is a codon that specifies the start of RNA translation.
Stop codon is a codon that specifies the end of RNA translation. There are mainly three stop codons UGA, UAA and UAG.
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 27 Solutions
Pearson eText Fundamentals of General, Organic, and Biological Chemistry -- Instant Access (Pearson+)
- Explain the significance of the following statement: The functioning of the aminoacyl-tRNA synthetases is referred to as the second genetic code.arrow_forwardThe following RNA sequence represents a small messenger which can be translated in a prokaryotic cell: 5'-ACGAAUGCACAGUAAAACUGGCUAGCGUAGGCUGA-3 Assume that the messenger RNA is translated in the cell, using the correct machinery and signals required for accurate protein synthesis. Using this RNA sequence and the Genetic Code Dictionary (see your textbook for the dictionary), solve the following problems A. Write the sequence of a protein that would be translated from this mRNA, using the appropriate stop and start signals, and indicating the correct termini of the protein product. B. Suppose that the underlined A in the sequence is changed to a U. Write the expected protein product of this mRNA.arrow_forwardRefer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codonarrow_forward
- (b) Hemoglobin is made of B-globin subunits. The first few mRNA nucleotides for B- globin are given by: (1) (iii) (iv) Write down the DNA sequence that has led to this mRNA and indicate the sense and non-sense strands and the polarity. CE Derive the polypeptide for the sequence using the table of the genetic code (Table Q1 below) and indicate the polarity of the polypeptide chain. First Position (5' end) U A single point mutation in mRNA sequence can cause sickle cell anemia by changing the amino acid Glu to Val. For the given mRNA, indicate the point mutations for the first Glu in the polypeptide sequence that can cause this disease. 5'-AUGGUCCACCUGACUCCUGAGGAGAAG...UGA-3' C The polypeptide of B-globin contains the amino acid Leu. Write down all the anticodons of the tRNA molecules that can potentially code for Val. Indicate the polarity of the anti-codon. A G Table 1. The Codons of the Genetic Code Second Position U Phe Phe Leu Leu Leu Leu Leu Leu Ile Ile Ile Met-Start Val Val Val…arrow_forwardFor the m-RNA nucleotide codons given below, what is the corresponding sequence of amino acids? AUG UGU AUA UAU GUA AUC ACC UUC UAU GUA ACA UUU UGG AAC AGC UGC CAU GUA UAC CAG AAA CUU GCA GAG CUG GCU UUG AUA UGA The α-helices are known to contain primarily the amino acids methionine, alanine, leucine, glutamate, and lysine, while β-pleated sheets are known to primarily contain the amino acids tryptophan, tyrosine, phenylalanine, isoleucine, valine, and threonine. Which one of these two types of secondary protein structure is present with this amino acid sequence?arrow_forwardTranslate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’arrow_forward
- Compare the severity of DNA mutations that produce the following changes in mRNA codons:(a) GCU to GCC (b) ACU to AUUarrow_forwardUsing the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA that would translate the synthesis of the following pentapeptide:Arg · Ile · Cys · Tyr · Valarrow_forwardAssume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. 5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'arrow_forward
- Using the genetic code table provided below, identify the open reading frame in this mRNA sequence, and write out the encoded 9 amino acid long peptide sequence: 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU C A G U UUU Phe UCU Ser UUC Phe UCC Ser UAC UCA Ser UAA UCG Ser UAG UUA Leu Leu G C CUU Leu CUC Leu CCC CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met ACG ACU Thr ACC Thr ACA Thr Thr A UAU Tyr UGU Cys Tyr UGC Cys CCU Pro CAU His CGU Arg Pro CAC His Pro CAA Gln CGC Arg CGA Arg CCA CCG Pro CAG Gln CGG Arg GUU Val GCU Ala GAU GUC Val GCC Ala GAC GUA Val GCA Ala GAA GUG Val GCG Ala GAG Stop UGA Stop UGG AAU Asn AAC AAA AAG AGU Asn AGC G Lys Lys Asp Asp Glu Glu Stop A Trp Ser Ser AGA Arg AGG Arg GGU Gly GGC Gly UCAG GGA Gly GGG Gly с U C A G U C A G U C A Garrow_forwardGiven the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)arrow_forwardIf there are 64 possible codons in the genetic code and the amino acid is specified by each, as read in the 5’ to 3’ direction from the mRNA sequence, which ones are STOP codons?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)