(a)
Interpretation:
It should be determined that whether the given base sequences are sticky or not sticky.
Concept Introduction:
A base is nitrogen containing heterocyclic compound which is found in DNA and RNA.
There are mainly four nitrogen bases found in DNA and they are,
- (1) Adenine
- (2) Guanine
- (3) Cytosine
- (4) Thymine
Short stretches of single stranded DNA are sticky (complementary) to each other. If both ends are cut with the same enzyme, the sticky ends will stick together by complementary base pairing, forming hydrogen bonds.
In DNA, Adenine always makes a double bond with thymine (
(b)
Interpretation:
It should be determined that whether the given base sequences are sticky or not sticky.
Concept introduction:
A base is nitrogen containing heterocyclic compound which is found in DNA and RNA.
There are mainly four nitrogen bases found in DNA and they are,
- (1) Adenine
- (2) Guanine
- (3) Cytosine
- (4) Thymine
Short stretches of single stranded DNA are sticky (complementary) to each other. If both ends are cut with the same enzyme, the sticky ends will stick together by complementary base pairing, forming hydrogen bonds.
In DNA, Adenine always makes a double bond with thymine (
(c)
Interpretation:
It should be determined that whether the given base sequences are sticky or not sticky.
Concept introduction:
A base is nitrogen containing heterocyclic compound which is found in DNA and RNA.
There are mainly four nitrogen bases found in DNA and they are,
- (1) Adenine
- (2) Guanine
- (3) Cytosine
- (4) Thymine
Short stretches of single stranded DNA are sticky (complementary) to each other. If both ends are cut with the same enzyme, the sticky ends will stick together by complementary base pairing, forming hydrogen bonds.
In DNA, Adenine always makes a double bond with thymine (
Want to see the full answer?
Check out a sample textbook solutionChapter 27 Solutions
Pearson eText Fundamentals of General, Organic, and Biological Chemistry -- Instant Access (Pearson+)
- Each of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer 5'GCCTCCGGAGACCCATTGG 3' Reverse primer 5'TTCTAAGAAACTGTTAAGG 3' (b) Forward primer 5'GGGGCCCCTCACTCGGGGCCCC 3'Reverse primer 5'TCGGCGGCCGTGGCCGAGGCAG 3' (c) Forward primer 5'TCGAATTGCCAATGAAGGTCCG 3'Reverse primer 5'CGGACCTTCATTGGCAATTCGA 3'arrow_forwardAre the following base sequences sticky or not sticky? Each piece is written 5′ to 3′.(a) TTAGC and GCTAA(b) CGTACG and CCTTCGarrow_forwardThe DNA sequence you use will be the following: T - A - G - C - C - A. You will need to make the complementary strand - fill in the table below with the complementary base pairs (remember Chargaff’s rule: A = T and C = G) 5’ T A G C C A 3’ 3’ 5’arrow_forward
- Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules, as well as the directionality of the strands: 5'- CGAGGCTAGGTTAACCTG-3'arrow_forwardb) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be the complimentary RNA strand? Provide the direction as well as 5" and 3" indicators for the new genetic genome. 5" G-A-A-C-T-G-G-A^T-T-C-T-A-C-C3'.arrow_forwardThe enzymes BamH I and Bal II recognise different sequences but leave the same stickyends: BamH I: ----------G|G A T C C ------ Bal II: ----------A|G A T C T ------(i)Will the two enzymes result in the same number of fragments in a random DNAsequence? Give reasons.(ii)What’s the advantage of having such a pair of REs? Explain with example.arrow_forward
- A duplex DNA molecule contains a random sequence of the four nucleotides with equal proportions of each. What is the average spacing between consecutive occurrences of the sequence 5'-ATGC-3'? Between consecutive occurrences of the sequence 5'-TACGGC-3'?arrow_forwardIf the recognition sequence of the restriction enzyme HindiIl is AAGCTT, then how many covalent bonds will be broken by the enzyme in the following DNA molecule? 5'-T-C-A-A-G-C-T-T-C-G-A-A-G-C-T-T-G-A-3 3-A-G-T–T-C-G-A-A-G-C -T-T-C-G-A-A-C-T-5 А. 1 В. 2 С.3 D. 4arrow_forwardWhich of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA binding protein? (Note that only one strand of the DNA is shown - you will find it helpful to write down the sequence and the sequence of the opposite strand to answer this question.) a) 5’- G A G C G A T C G C T C - 3’ b) 5’- G A G C G A G A G C G A - 3’ c) 5’- G A G C G A A G C G A G - 3’arrow_forward
- Draw the structure of a G ∙ U base pair.arrow_forwardA single strand of DNA, 24 nucleotides long, with the sequence 5'-TTTCCCgggAAAgggTTTAAAggg-3' is in a test tube. (Note that G's are shown in lowercase, so that your eye can better distinguish them from C's) Other than the appropriate buffer solution, what else needs to go in the test tube to so that we end up with a piece of double stranded DNA, 24 base pairs long, with the above sequence comprising one of the two strands?arrow_forwardChoose all of the statements that correctly describe the base pairs drawn below. A C H H-N -H-N N-H- -N B H D موعة Rita N -H---- 2 NHN O- -H-N H -H- N- -H-N The non-Watson-Crick base pair shown in A is much less stable than the base pairs shown in B and C, because the smaller size of the two pyrimidine bases induces a distortion in the structure of the double helix that decreases the stability of the helix when compared to helices with the normal Watson-Crick base pairs. The base pair shown in B is found in BOTH DNA and RNA The base pair shown in C is found ONLY in RNA and NOT DNA The base pair seen in B is more stable than the Watson-Crick base pair shown in C partly because of a larger number of hydrogen bonds and partly because of more favourable pi-stacking interactions with adjacent base pairs.arrow_forward
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON