![Pearson eText Fundamentals of General, Organic, and Biological Chemistry -- Instant Access (Pearson+)](https://www.bartleby.com/isbn_cover_images/9780135213759/9780135213759_largeCoverImage.gif)
Concept explainers
Interpretation:
The severity of DNA mutation that produced in the given changes in mRNA codons has to be compared.
Concept Introduction:
Mutation: Mutation is the error occurred in the base sequence of a DNA which is passed along when
Codons are the sequence of three bases in mRNA that specifies the amino acid to be incorporated into a protein.
Some amino acids and their corresponding mRNA codons are listed below,
Start codon is a codon that specifies the start of RNA translation.
Stop codon is a codon that specifies the end of RNA translation. There are mainly three stop codons UGA, UAA and UAG.
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 27 Solutions
Pearson eText Fundamentals of General, Organic, and Biological Chemistry -- Instant Access (Pearson+)
- Dystrophin is mutated in the disease, causing a codon to change from GGA to UGA. What is the consequence of this change? (arrow_forwardExplain the term mutation.arrow_forwardExplain the steps of RNA translation into protein. Mutations: The codon GGA encodes the amino acid glycine. Identify the type of mutation for each of the following changes (name both the type of mutation and what the new codon would produce): GGA to GGG GGA to UGA GGA to GAGA GGA to AGAarrow_forward
- explain why a mutation in the dna nucleotide sequence that corresponds to the 3rd nitrogen base in the mrna codon is not as serious as a mutation in the dna that corresponds to the first nitrogen base in the mrna codonarrow_forwardDefine the silent mutation in DNAarrow_forwardProvide the abbreviation for the amino acid sequence expected from the following mRNA segment using the three-letter amino acid codes: 5' UUUICCCIAAUIAUUIACG 3'arrow_forward
- Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’arrow_forwardTranslate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’arrow_forwardConsider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forward
- Label the following regions on this tRNA molecule, stating the function of each:arrow_forwardMetabolic syndrome is a genetic disorder with symptoms of hypertension, elevated blood cholesterol concentrations, and lower-than-normal blood magnesium concentrations. This syndrome is caused by a mutation in mitochondrial DNA (mtDNA) in which a thymine nucleotide is replaced by a cytosine nucleotide. Which of the following identifies the mutated mtDNA and the corresponding mRNA and tRNA produced in a person with metabolic syndrome if the normal mtDNA triplet is TCG? Select one: a. Mutated mtDNA: CCG mRNA: GGC tRNA: GGC b. Mutated mtDNA: TCG mRNA: UGC tRNA: ACG c. Mutated mtDNA: CCG mRNA: GGC tRNA: CCG d. Mutated mtDNA: TTG mRNA: AAC tRNA: UUCarrow_forwardGiven the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781337392938/9781337392938_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305112100/9781305112100_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)