![Pearson eText Fundamentals of General, Organic, and Biological Chemistry -- Instant Access (Pearson+)](https://www.bartleby.com/isbn_cover_images/9780135213759/9780135213759_largeCoverImage.gif)
Pearson eText Fundamentals of General, Organic, and Biological Chemistry -- Instant Access (Pearson+)
8th Edition
ISBN: 9780135213759
Author: John McMurry, David Ballantine
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 27, Problem 27.50CP
Interpretation Introduction
Interpretation:
The effect of mutation on the given sequence of the protein produced should be determined.
Concept Introduction:
Gene mutation:
Mutations are changes in genomic sequence, and are changes in a genes DNA sequence that can alter the amino acid sequence of the protein encoded by the gene.
In gene mutations, the DNA code will have a base (or) more missing added or exchanged in a codon.
Any changes in DNA sequence can result in change in protein function is called mutation.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
If the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became A-C-T-G-G-C-C-T-A, what effect would the mutation have on the sequence of the protein produced?
b) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be the
complimentary RNA strand? Provide the direction as well as 5" and 3" indicators for the new genetic
genome.
5" G-A-A-C-T-G-G-A^T-T-C-T-A-C-C3'.
What sequence of bases on one strand of DNA (reading in the 3′ to 5′ direction) is complementary to the sequence 5′ T-A-T-G-C-A-G 3′ on the other strand?
Chapter 27 Solutions
Pearson eText Fundamentals of General, Organic, and Biological Chemistry -- Instant Access (Pearson+)
Ch. 27.1 - Decode the following sequence of letters to find...Ch. 27.3 - Prob. 27.1CIAPCh. 27.3 - Prob. 27.2CIAPCh. 27.3 - Prob. 27.3CIAPCh. 27.3 - Prob. 27.2KCPCh. 27.4 - Prob. 27.3PCh. 27.4 - A restriction enzyme known as EcoRI cuts DNA in...Ch. 27.4 - Prob. 27.5PCh. 27.5 - Classify the following activities according to the...Ch. 27.5 - Prob. 27.4CIAP
Ch. 27.5 - Prob. 27.5CIAPCh. 27.5 - Prob. 27.6CIAPCh. 27 - What steps are necessary in the mapping of the...Ch. 27 - Prob. 27.8UKCCh. 27 - List the four types of noncoding DNA (see Section...Ch. 27 - In general, what are the differences between...Ch. 27 - What is recombinant DNA? How can it be used to...Ch. 27 - Identify some major potential benefits of the...Ch. 27 - Prob. 27.13APCh. 27 - Prob. 27.14APCh. 27 - Prob. 27.15APCh. 27 - Prob. 27.16APCh. 27 - Prob. 27.17APCh. 27 - Prob. 27.18APCh. 27 - Prob. 27.19APCh. 27 - You may have heard of Dolly, the cloned sheep...Ch. 27 - Prob. 27.21APCh. 27 - Prob. 27.22APCh. 27 - What is the role of the enzyme telomerase? In what...Ch. 27 - Prob. 27.24APCh. 27 - Prob. 27.25APCh. 27 - Prob. 27.26APCh. 27 - Prob. 27.27APCh. 27 - What is a SNP?Ch. 27 - How are SNPs linked to traits in individual human...Ch. 27 - List some potential biological effects of SNPs.Ch. 27 - Prob. 27.31APCh. 27 - Prob. 27.32APCh. 27 - Prob. 27.33APCh. 27 - Prob. 27.34APCh. 27 - Prob. 27.35APCh. 27 - Prob. 27.36APCh. 27 - Prob. 27.37APCh. 27 - Prob. 27.38APCh. 27 - In the formation of recombinant DNA. a restriction...Ch. 27 - Give the sequence of unpaired bases that would be...Ch. 27 - Are the following base sequences sticky or not...Ch. 27 - Prob. 27.42APCh. 27 - Prob. 27.43APCh. 27 - Provide two examples of genetically engineered...Ch. 27 - Prob. 27.45APCh. 27 - Why is the field of bioethics so important in...Ch. 27 - Prob. 27.47CPCh. 27 - Prob. 27.48CPCh. 27 - Prob. 27.49CPCh. 27 - Prob. 27.50CPCh. 27 - What is a restriction endonuclease?Ch. 27 - Prob. 27.52CPCh. 27 - Prob. 27.53GPCh. 27 - One of the most actively pursued areas in genomics...Ch. 27 - Prob. 27.55GP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?arrow_forwardThe DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’ and Non-template strand = 5' - ATG-TCG-TGA-GTC-AGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation? 4th sequence (from the left) should be = TCG right?arrow_forwardWhat is the nucleotide sequence of the DNA strand that is complementary to 5'-GGCGCAACTGTCACAA-3'?arrow_forward
- A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: G G C T A G C T G C T T C C T T G G G G A C C G A T C G A C G A A G G A A C C C C T Template strand with its polarity: 3’ C C G A T C G A C G A A G G A A C C C C T 5’ - Coding strand with its polarity: 3’ G G C T A G C T G C T T C C T T G G G G A 5’ Please write out the mRNA sequence generated by the template strand to produce that polypeptide chain.arrow_forwardIf the sequence of one strand of a DNA molecule is 5’-AGCCCCGACTCTATTC-3’, what is the sequence of the complementary strand?arrow_forwardThe following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Indicate the 3’ and 5’ ends of both strands. G C T A T A A T G G C A a a a t t g G G T C A G G C A a a t c g a C A T A G C T G A C G G g g a t g a G G T T A A C G A T A T T A C C G T t t t a a c C C A G T C C G T t t a g c t G T A T C G A C T G C C c c t a c t C C A A T T 2.Write the pre-mRNA molecule. Indicate the 3’ and 5’ ends. 3. Write the mRNA molecule. Indicate the 3’ and 5’ ends 4. Write the tRNA anticodons corresponding to the codons in the mRNA. 5. Write the sequence of amino acids in the resulting polypeptide.arrow_forward
- If a 100 base-pair double-stranded DNA fragment has 40 cytosines, how many adenines does it contain?arrow_forwardWhat part(s) of a nucleotide (namely, phosphate, sugar, and/or base) is/are found in the major and minor grooves of double-stranded DNA, and what part(s) is/are found in the DNA backbone? If a DNA-binding protein does not recognize a specific nucleotide sequence, do you expect that it binds tothe major groove, the minor groove, or the DNA backbone? Explain.arrow_forwardWhich of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA binding protein? (Note that only one strand of the DNA is shown - you will find it helpful to write down the sequence and the sequence of the opposite strand to answer this question.) a) 5’- G A G C G A T C G C T C - 3’ b) 5’- G A G C G A G A G C G A - 3’ c) 5’- G A G C G A A G C G A G - 3’arrow_forward
- Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?arrow_forwardIf one strand of a DNA molecule has the base sequence 5′-AGCATTAAGCT-3′, what is the base sequence of the other, complementary strand?arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781319114671/9781319114671_smallCoverImage.jpg)
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
![Text book image](https://www.bartleby.com/isbn_cover_images/9781464126116/9781464126116_smallCoverImage.gif)
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
![Text book image](https://www.bartleby.com/isbn_cover_images/9781118918401/9781118918401_smallCoverImage.gif)
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134015187/9780134015187_smallCoverImage.gif)
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
Bacterial Endospore Formation -Biology Pundit; Author: Biology Pundit;https://www.youtube.com/watch?v=6_sinRhE8zA;License: Standard YouTube License, CC-BY
Taxonomy of Bacteria: Identification and Classification; Author: Professor Dave Explains;https://www.youtube.com/watch?v=8IJRzcPC9wg;License: Standard YouTube License, CC-BY