Study Guide With Student Solutions Manual And Problems Book For Garrett/grisham's Biochemistry, 6th
Study Guide With Student Solutions Manual And Problems Book For Garrett/grisham's Biochemistry, 6th
6th Edition
ISBN: 9781305882409
Author: GARRETT, Reginald H.; Grisham, Charles M.
Publisher: Brooks Cole
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 29, Problem 1P
Interpretation Introduction

Interpretation:

The nucleotide sequence of the DNA template and the N-terminal amino acid sequence of proton encoded by it need to be determined

Concept introduction:

Nucleic acids and deoxyribonucleic acid particularly, are key macro molecules for the life processes. Deoxyribonucleic acid bears the hereditary data that is transferred to children from their parents, providing directions for the way (and when) to form numerous proteins required to make and maintain the cell functioning in the organisms.

Expert Solution & Answer
Check Mark

Answer to Problem 1P

  Met-Ala-lle-Ser-Thr-Lys-Thr-Pro-Arg-Glu-Ser…

Explanation of Solution

The 3’ end of messenger ribonucleic acid can complement the 5’ end of the deoxyribonucleic acid transcribed from it. The deoxyribonucleic acid sequence can be represented from 5’ to 3’ as follows.

  5’-…GGATTCCCTAGGAGTCTTCGTCGTCGATCGCCATACGGATCT…-3

The amino group end of the aminoalkanoic acid sequence can start from the primary AUG sequence ranging from the 5’ end.

  5’-…AUG GCG AUC UCG ACU AAG ACU CCU AGG GAA UCC…-3’

This ends up in the subsequent organic compound sequence as follows:

  Met-Ala-lle-Ser-Thr-Lys-Thr-Pro-Arg-Glu-Ser…

Conclusion

The 3’ end of ribonucleic acid can complement the 5’ end of the deoxyribonucleic acid transcribed from it. The N-terminal aminoalkanoic acid sequence can begin from the primary AUG sequence ranging from the 5’ end.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
mRNA: 5’ – UGAUCAUGAUCUCGUAAGAUAUC – 3’  -Draw a box around the sequence where protein synthesis will begin. What is this sequence called? Does an amino acid get inserted at this site? If so, which one? -Draw in an arrow to show the direction that a ribosome will move along the mRNA strand. -From the starting point, mark off the codons, and identify the correct amino acid that will be inserted at that codon.  -Draw a second box around the sequence where protein synthesis will stop. What is this sequence called? -Label the N-terminus and C-terminus of the polypeptide (amino acid) chain.
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC   1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
Translation  What are the stop/nonsense codons? How is the growing polypeptide released from the ribosomal assembly?
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
  • Text book image
    Biochemistry
    Biochemistry
    ISBN:9781305577206
    Author:Reginald H. Garrett, Charles M. Grisham
    Publisher:Cengage Learning
    Text book image
    Biology 2e
    Biology
    ISBN:9781947172517
    Author:Matthew Douglas, Jung Choi, Mary Ann Clark
    Publisher:OpenStax
    Text book image
    Biochemistry
    Biochemistry
    ISBN:9781305961135
    Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
    Publisher:Cengage Learning
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY