Biological Science (7th Edition)
7th Edition
ISBN: 9780134678320
Author: Scott Freeman, Kim Quillin, Lizabeth Allison, Michael Black, Greg Podgorski, Emily Taylor, Jeff Carmichael
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 3, Problem 3TYK
What type of information is used to direct different polypeptides to fold into differentshapes?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Consider the following in light of the concept of levels of structure (primary, secondary, tertiary, quaternary) as defined for proteins. (a) What level is shown by doublestranded DNA? (b) What level is shown by tRNA? (c) What level is shown by mRNA?
Consider the following peptide to answer the questions below:
A M A K K E S H I F T A I D E
What is the total charge of this peptide at pH = 5?
What is the N terminal amino acid (full name)? C terminal amino acid?
How many fragments would result if this peptide underwent proteolytic cleavage with V-8 protease and what are these fragments (list them)?
Would this peptide be a candidate to form an alpha helix? Why or why not
How does a polypeptide fold to become a functioning protein?
Chapter 3 Solutions
Biological Science (7th Edition)
Ch. 3 - 1. What two functional groups are bound to the...Ch. 3 - What type of information is used to direct...Ch. 3 - Prob. 5TYUCh. 3 - Prob. 6TYUCh. 3 - 7. Why are proteins not considered to be a good...Ch. 3 - Prob. 9TYPSSCh. 3 - Prob. 12PIATCh. 3 - Prob. 13PIATCh. 3 - Recall that proline often introduces kinks in the...Ch. 3 - SOCIETY Based on the experiment in question 15,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How do chaperonins assist polypeptides to become fully functional proteins?arrow_forwardWhy is it no longer considered necessary to determine theN-terminal amino acid of a protein as a separate step?arrow_forwardWhat forces come into play with protein folding (please explain this at the molecular level)?arrow_forward
- Describe several functions of polypeptides.arrow_forward(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21arrow_forwardA monomeric protein contains 154 amino acids. How many codons code for these amino acids? How many nucleotides?arrow_forward
- Can the tertiary structure of a protein depend on the type of cell system used for synthesis? Explain.arrow_forwardWhat drives spontaneous folding into the correct tertiary structure for a newly synthesized protein?arrow_forwardWhere would you expect a polypeptide region Ridge and the amino acid valine, leucine, and isoleucine to be located in a folded polypeptide? explainarrow_forward
- A. Where would you expect valine, leucine, and isoleucine to be located in a polypeptide? (Inside or outside)? Explain your answer using the properties of the amino acids listed. B.How would your answer change, if the amino acids were Lysine and Histidine?arrow_forwardIf an Arg residue in a protein was replaced with either Lys or Glu amino acid, whichsubstitution would you expect to result in the greatest structural change and why?arrow_forwardIllustrate how cohesin proteins form a V-shape heterodimer.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY