Concept explainers
(a)
Interpretation:
Nucleolus of 3 different tissue that is brain, liver and muscle are collected and allowed to undergo transcription. The RNA was applied to DNA chips. The cause of intensity of hybridization differing from gene to gene is to be described.
Concept introduction:
DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it, due to complementary nature of
(b)
Interpretation:
The cause of different hybridization pattern of same RNA in different tissue is to be described.
Concept introduction:
DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it, due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.
(c)
Interpretation:
The cause of expression of some genes in all the tissues are to be described.
Concept introduction:
DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.
(d)
Interpretation:
Cause of addition of inhibition inhibitor in sample is to be proposed.
Concept introduction:
DNA chip technology is also known as the DNA microarray technology. In this process different genes or piece of DNA are collected in a microarray. These genes are attached to a solid surface. When the sample of polynucleotide strand is added upon it due to complementary nature of nucleotides specific polynucleotide strand will attach to its complementary strands only. And the intensity of shading helps in identifying which polynucleotide stands were there in the sample.
Want to see the full answer?
Check out a sample textbook solutionChapter 30 Solutions
BIOCHEMISTRY W/1 TERM ACHEIVE ACCESS
- 34) What amino acid sequence is coded for by the following DNA coding strand? (Recall: the DNA template strand runs 5' to 3' and the mRNA strand runs antiparallel to the DNA template strand. Recall that DNA is translated with a start codon.) 5'-TTATGCGACCAGACCAGTTT-3' Coding strandarrow_forward1arrow_forwarde.) ( acid buffer an appropriate choice? Why or why not? If I need to perform an enzymatic reaction at pH 6.5, is a citric )Describe the process of transcription in as much detail as possible using pictures and words beginning with a paired (duplexed) strand of DNA and ending with a processed mRNA which is ready for translation. 7.arrow_forward
- pls answerrrr. thank youuuarrow_forwardRNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA. This strand contains both a gene and its promoter region. Circle the promoter region in blue, draw a yellow box around the TATA box, draw a green box around the start codon, and draw a red box around the stop codon: TATATATATTACGTTGCATACGCTCAACGGTCGAAACTGCATGGGCAC ATATATATAATGCAACGTATGCGAGTTGCCAGCTTTGACGTACCCG Now imagine this gene has been transcribed into RNA. What would that RNA strand look like? Before the above RNA strand can be translated, a few modifications must first take place (in eukaryotes). What are they? 1) 2) 3) Using a codon chart of your choice (one can be found here, or here) translate the above RNA transcript (assume no splicing took place). Write the three letter abbreviations for the amino acids in the image below: Now imagine that a mutation took place in the original strand of DNA (marked in red) TATATATATTACGTTGCATACCCTCAACGGTCGAAACTGCATG…arrow_forwardGive Detailed explanation Solutionarrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning