BIOCHEMISTRY
9th Edition
ISBN: 2818440090622
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 31, Problem 52P
Interpretation Introduction
Interpretation:
The tissue specificity of eIF2 mutation should be determined.
Concept introduction:
Vanishing white matter is a leukoencephalopathy that affects the white matter of the brain and the spinal cord. White matter consists of nerve fibers covered with a myelin sheath. Myelin sheath is made up of fatty acids, whose function is to insulate and protect the nerve fibers.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Mutations that introduce stop codons cause a number of genetic diseases. For example, from 2% to 5% of the people who have cystic fibrosis possess a mutation that causes a premature stop codon in the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR). This premature stop codon produces a truncated form of CFTR that is nonfunctional and results in the symptoms of cystic fibrosis. One possible way to treat people with genetic diseases caused by these types of mutations is to trick the ribosome into reading through the stop codon, inserting an amino acid in its place. Although the protein produced may have one altered amino acid, it is more likely to be at least partly functional than is the truncated protein produced when the ribosome stalls at the stop codon. Indeed, geneticists have conducted clinical trials of a drug called PTC124 on people with cystic fibrosis. This drug interferes with the ribosome’s ability to correctly read stop codons (C. Ainsworth.…
Mutations that introduce stop codons cause a number of genetic diseases. For example, from 2% to 5% of the people who have cystic fibrosis possess a mutation that causes a premature stop codon in the gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR). This premature stop codon produces a truncated form of CFTRthat is nonfunctional and results in the symptoms of cystic fibrosis . One possible way to treat people with genetic diseases caused by these types of mutations is to trick the ribosome into reading through the stop codon, inserting an amino acid in its place. Although the protein produced may have one altered amino acid, it is more likely to be at least partly functional than is the truncated protein produced when the ribosome stalls at the stop codon. Indeed, geneticists have conducted clinical trials of a drug called PTC124 on people with cystic fibrosis. This drug interferes with the ribosome’s ability to correctly read stop codons . On the basis of…
Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation:
a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________
b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion
c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…
Chapter 31 Solutions
BIOCHEMISTRY
Ch. 31 - Prob. 1PCh. 31 - Prob. 2PCh. 31 - Prob. 3PCh. 31 - Prob. 4PCh. 31 - Prob. 5PCh. 31 - Prob. 6PCh. 31 - Prob. 7PCh. 31 - Prob. 8PCh. 31 - Prob. 9PCh. 31 - Prob. 10P
Ch. 31 - Prob. 11PCh. 31 - Prob. 12PCh. 31 - Prob. 13PCh. 31 - Prob. 14PCh. 31 - Prob. 15PCh. 31 - Prob. 16PCh. 31 - Prob. 17PCh. 31 - Prob. 18PCh. 31 - Prob. 19PCh. 31 - Prob. 20PCh. 31 - Prob. 21PCh. 31 - Prob. 22PCh. 31 - Prob. 23PCh. 31 - Prob. 24PCh. 31 - Prob. 25PCh. 31 - Prob. 26PCh. 31 - Prob. 27PCh. 31 - Prob. 28PCh. 31 - Prob. 29PCh. 31 - Prob. 30PCh. 31 - Prob. 31PCh. 31 - Prob. 32PCh. 31 - Prob. 33PCh. 31 - Prob. 34PCh. 31 - Prob. 35PCh. 31 - Prob. 36PCh. 31 - Prob. 37PCh. 31 - Prob. 38PCh. 31 - Prob. 39PCh. 31 - Prob. 40PCh. 31 - Prob. 41PCh. 31 - Prob. 42PCh. 31 - Prob. 43PCh. 31 - Prob. 44PCh. 31 - Prob. 45PCh. 31 - Prob. 46PCh. 31 - Prob. 47PCh. 31 - Prob. 48PCh. 31 - Prob. 49PCh. 31 - Prob. 50PCh. 31 - Prob. 51PCh. 31 - Prob. 52P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting (factor IX). This defective protein was caused by a mutation that altered the splicing of the exons. This genetic change in the splicing pattern created a new stop codon in the mRNA for factor IX. What effect on the polypeptide chain of factor IX would this new stop codon have?arrow_forwardHemophilia in the Russian royal family was caused by defective protein involved in blood clotting (factor IX). This defective protein was caused by a mutation that altered the splicing of the exons. This genetic change in the splicing pattern created a new stop codon in the mRNA for factor IX. What effect might this new stop codon have on the primary and tertiary levels of the mutant factor IX protein (compared to the native or wild-type protein).arrow_forwardWhy is the ErbB family pathway an important pathway for researchers that target cancer therapy. explain in 3-5 sentences.arrow_forward
- Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting (factor IX). This defective protein was caused by a mutation that altered the splicing of the exons. This genetic change in the splicing pattern created a new stop codon in the mRNA for factor IX. Is it likely that the mutation has altered at least one base at the exon-intron boundary in the wild-type pre-mRNA? Why or why not?arrow_forwardSome silent mutations have been found to be associated with disease. Suggest a possible mechanism for this. How would you test this hypothesis?arrow_forwardYou may wish to consult the genetic code above to answer the following question. A mutation has changed a portion of a protein coding gene that encodes a messenger RNA sequence. The original messenger RNA sequence is 5-AUGCCCAGAGCU-3' Which mutation is a nonsynonymous (missense) mutation that changes a single amino acid in the encoded protein? O 5-AUGCCCAGGGCC-3' O 5'-AUGCCCUGAGCU-3' O 5'-AUGCCCACAGCU-3 5'-AUGCCCCAGAGCU-3arrow_forward
- Which of the following concerning progeria are false? Choose all that apply. 1. Normally, Zmpste24 cuts pre-lamin to remove 50 amino acids 2. Exon 11 in LaminA codes for the binding site of Zmpste24 3. Progerin does not associate with the nuclear membrane due in part to the extra 18 amino acids it contains 4. The silent mutation known to cause Progeria results in a splicing defect affecting formation of mature LaminAarrow_forwardHemophilia in the Russian royal family was caused by defective protein involved in blood clotting (factor IX). This defective protein was caused by a mutation that altered the splicing of the exons. This genetic change in the splicing pattern created a new stop codon in the mRNA for factor IX. Give an example of how a mutation that altered the splicing sites in the pre-mRNA might lead to a premature stop codon in the gene.arrow_forwardGive 7 examples where a specific nucleotide sequences/elements are recognized by protein or protein/RNA complex, from lecture 3.1-3.6. at least one examples from prokaryotic transcription, eukaryotic transcription, RNA processing, RNA stability, translation respectively. For each example, list the specific DNA/RNA sequences/elements and the protein or complex. E.g. eukaryotic promoter, transcription factor, transcription initiation.arrow_forward
- Below is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?arrow_forwardSome of the mutations of the type mentioned in Problem 28 have an interesting property: they prevent the formation of the antiterminator that normally takes place when the tryptophan level is low. In one of these mutations, the AUG start codon for translation of the 5′ UTR has been deleted. How might this mutation prevent antitermination from taking place?arrow_forwardAn individual carries a somatic mutation that changes a lysinecodon into a glutamic acid codon. Prior to acquiring this mutation,the individual had been exposed to UV light, proflavin, and5-bromouracil. Which of these three agents would be the mostlikely to have caused this somatic mutation? Explain your answer.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781319114671/9781319114671_smallCoverImage.jpg)
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
![Text book image](https://www.bartleby.com/isbn_cover_images/9781464126116/9781464126116_smallCoverImage.gif)
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
![Text book image](https://www.bartleby.com/isbn_cover_images/9781118918401/9781118918401_smallCoverImage.gif)
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134015187/9780134015187_smallCoverImage.gif)
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY