BIOCHEMISTRY W/1 TERM ACHEIVE ACCESS
9th Edition
ISBN: 9781319425746
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 32, Problem 12P
Interpretation Introduction
Interpretation:
In the given figure, the frequency of the codons used for threonine should be determined.
Concept introduction:
tRNA (transfer ribonucleic acid) is a type of RNA, which decodes mRNA into a protein sequence. During the process of translation, tRNAs bind to specific sites on the ribosome. For each codon on mRNA, there is an anticodon on tRNA. Binding of these two RNAs helps in the proper synthesis of proteins.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
An extra piece. In one type of mutation leading to a form of
thalassemia, the mutation of a single base (G to A) generates a new 3'
3' splice site (blue in the illustration below) akin to the normal one
(yellow) but farther upstream.
Normal 3' end
of intron
5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3'
5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3'
What is the amino acid sequence of the extra segment of protein
synthesized in a thalassemic patient having a mutation leading to
aberrant splicing? The reading frame after the splice site begins with
TCT.
AAAGAGAAAAGAAUA
to AAAGAGAAAUGAAUA.
Suppose the codon sequence
has a single base pair mutation
If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene?
(Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.)
Submit Answer
Retry Entire Group No more group attempts remain
RNA sequence.
ate 3' and 5' ends on BOTH strands
ate which strand served as the TEMPLATE strand and which
ING strand
Chapter 32 Solutions
BIOCHEMISTRY W/1 TERM ACHEIVE ACCESS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- True or False. Explain. A) At no time during protein synthesis does an amino acid make direct contact with the mRNA being translated. B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.arrow_forwardQuestion 8 Review translation. Match the term and its description. Each term can only be used once. This site holds the tRNA that carries the growing polypeptide chain | Choose ) This site holds the tRNA that carries the next amino acid to be | Choose J added to the chain This site is the exit site, where discharged tRNAS leave the [ Choose ) ribosome Initiation, elongation and termination | Choose J >arrow_forwardLeaderless. The MRNA for the A repressor begins with 5'-AUG-3', 5'-AUG-3', which encodes the methionine residue that begins the protein. What is unusual about this beginning? Would it cause the MRNA to translate efficiently or not?arrow_forward
- Hello , please help me with this question. I am struggling with naming the Amino Acid sequence from the RNA sequence . thank you ,arrow_forwardBe sure to answer all parts. Write a possible mRNA sequence that codes for each peptide. a. His-Cys-Tyr-Val-Ser 5¹- b. Phe-Val-Thr-Tyr-Glu 5'- 5'- c. Trp-Phe-Asn-Gln -3' U -3' с Table 26.2 The Genetic Code-Triplets in Messenger RNA First Base (5' end) -3' U UUU UUC UUA UUG CUU CUC CUA CUG AUL Phe Phe Leu Leu Leu Leu Leu Leu la C UCU UCC UCA UCG CCU CCC CCA CCG Second Base A UAU UAC UAA UAG CAU CAC CAA CAG Ser Ser Ser Ser Pro Pro Pro Pro Tyr 55 Tyr Stop Stop His His Gin Gin G UGU UGC UGA UGG CGU CGC CGA CGG Cys Cys Stop Trp Arg Arg Arg Arg Third Base (3¹ ond) DUAC DU AG с А Аarrow_forwardtRNA enzyme. Any given aminoacyl-tRNA synthetase: a. Attaches the amino acid to the 5′-end '5end of the tRNA b. Always recognizes only one specific tRNA c. Recognizes all tRNA molecules d. Forms an ester linkage between the amino acid and the tRNAarrow_forward
- Polymerase inhibition. Cordycepin inhibits poly(A) synthesis at low concentrations and RNA synthesis at higher concentrations. NH2 H. он Cordycepin (3'-deoxyadenosine) a. What is the basis of inhibition by cordycepin? b. Why is poly(A) synthesis more sensitive than the synthesis of other RNAS to the presence of cordycepin? c. Does cordycepin need to be modified to exert its effect?arrow_forwardPlease help me with this question. How many amino acid residues are in the heavy and light chains of the Fab fragment, and how many amino acid residues are in lysozyme?arrow_forwardTranscription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule (a.k.a. mRNA transcript). Strand 1 3’ End TTG CTT CAC CTT GCG CGC CCG CGC TAA TTG 5’ end mRNAarrow_forward
- Hi, help please. Which of the following is TRUE regarding RNA editing? a .The coding sequence is altered in the chromosome b. More than one answer choice is correct c. The mRNA is altered by Guide RNAs d. Translation first takes place, following by altering of the coding sequencearrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forwardComplements. The sequence of part of an mRNA is 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' What is the sequence of the DNA coding strand? Of the DNA template strand?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY