BIOCHEMISTRY W/1 TERM ACHEIVE ACCESS
9th Edition
ISBN: 9781319425746
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 32, Problem 14P
Interpretation Introduction
Interpretation:
The dissociation constant of lambda repressor-DNA complex and standard free energy of binding should be determined.
Concept introduction:
Theλ repressor in activated state binds to OR1 and OR2 sites and inhibits the transcription of phage gene. On the other hand, Cro protein binds to the same sites, to which λ repressor binds. In this way, the Cro protein inhibits the action of λ repressor.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Please help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5
determine what amino acid will be formed from the given DNA strand below:
3’ T A C A T G C C G A A T G C C 5’
Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain.
1. Partner DNA strand
2. the mRNA strand
3. The tRNA
4. the formed amino acids
5. the discussion of the entire procedure
True or False. Just write T if it is true and F if it is false.
In E. coli both RNA and protein synthesis take place in the cytoplasm.
Okazaki fragments are ssDNA CHAINS OF 100-200 nucleotides long, primed by very short RNA primers in bacteria.
In eukaryotic gene, the coding sequences are known as introns while the intervening sequences are the exons.
The central dogma refers to the fact that proteins are products of information encoded in RNA using a DNA intermediate.
The ends of the linear chromosomes are maintained by telomerase to prevent it from shortening during mitosis.
The Shine Delgarno sequence is where the RNA pol binds during transcription in prokaryotes
The sigma subunit of the E. coli RNA polymerase confers specificity to transcription.
Both DNA replication and transcription follow a 5’ to 3’ direction of polarity.
Nucleosomes are the structural unit of chromatin.
In the lagging strand, the enzyme X removes RNA primers attached by PRIMASE and this gap is then filled…
please help me with thi question.
What advantages do CRISPR‑Cas systems have over restriction enzymes and engineered nucleases for editing DNA?
The options are attached. Multiple answers can be chosen
Chapter 32 Solutions
BIOCHEMISTRY W/1 TERM ACHEIVE ACCESS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- please help me with this question. As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.arrow_forwardDraw a replication bubble. Be sure to label the directionality of all strands of DNA. For one of the two replication forks, draw and label all of the proteins required the text describes as being important for DNA synthesis, and label the leading and lagging strands.arrow_forwardAn extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.arrow_forward
- RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.arrow_forwardQuestion. What would the forward primer sequence look like if it were intended to bind the area of the DNA template?arrow_forwardNeed help ASAP. How do you use FISH(fluorescence in situ hybridization) to detect gene rearrangement? Describe an example with the detail of the disease and the procedure.arrow_forward
- True or False. Topoisomerase I does not require ATP to break and rejoin DNA strands because the energy of the phospho-diester bond is stored transiently in a phospho-tyrosine linkage in the enzyme’s active site. Explain your answer in 2-3 sentences.arrow_forwardTrue or False. In a comparison between the DNAs of related organisms such as humans and mice, conserved sequences represent functionally important exons and regulatory regions, and non-conserved sequences generally represent noncoding DNA. Explain your answer in 2-3 sentences.arrow_forwardTrue or False. Do single-stranded DNA strands stabilize other strands?arrow_forward
- In the DNA extraction. What is the role of alcohol in the DNA extraction process?arrow_forwardPolymerase inhibition. Cordycepin inhibits poly(A) synthesis at low concentrations and RNA synthesis at higher concentrations. NH2 H. он Cordycepin (3'-deoxyadenosine) a. What is the basis of inhibition by cordycepin? b. Why is poly(A) synthesis more sensitive than the synthesis of other RNAS to the presence of cordycepin? c. Does cordycepin need to be modified to exert its effect?arrow_forward. Pancreatic deoxyribonuclease I (DNase I) is a nuclease that makes single-strand nicks on double-stranded DNA. It has been observed that treatment of nucleosomal core particles with DNase I yields a peculiar result. When DNA from such a digestion is electrophoresed under denaturing conditions, the single-stranded fragments are observed to occur in a regular periodicity of about 10 bases. Suggest an explanation of this result in terms of the structure of the nucleo- some.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License