The primer that can be used when a reverse transcriptase activity is supposed to be assayed where polyriboadenylate is in the template needs to be determined. Also, the radioactive nucleotide that is to be used to follow chain elongation needs to be determined. Concept introduction: Primer is a single strand of nucleic acid . It is utilized by all the living organisms for the synthesis of DNA. The primers are removed before completion of DNA replication and DNA polymerases fill the gaps in the sequence with DNA. Scientists in the laboratory can design and synthesize DNA primers with particular sequences in a single-stranded DNA molecule that bind to DNA. In order to perform the polymerase chain reaction, these DNA primres are commonly used to copy pieces. Shellac primers based on oil, latex and pigmented are three different types of primers

Question

Want to see the full answer?

Answer 1

Question

Chapter 4, Problem 22P

Interpretation Introduction

Interpretation:

The primer that can be used when a reverse transcriptase activity is supposed to be assayed where polyriboadenylate is in the template needs to be determined. Also, the radioactive nucleotide that is to be used to follow chain elongation needs to be determined.

Concept introduction:

Primer is a single strand of nucleic acid. It is utilized by all the living organisms for the synthesis of DNA. The primers are removed before completion of DNA replication and DNA polymerases fill the gaps in the sequence with DNA. Scientists in the laboratory can design and synthesize DNA primers with particular sequences in a single-stranded DNA molecule that bind to DNA.

In order to perform the polymerase chain reaction, these DNA primres are commonly used to copy pieces. Shellac primers based on oil, latex and pigmented are three different types of primers

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Suppose that you want to assay reverse transcriptase activity. If polyriboadenylate is the template in the assay, what should you use as the primer? Which radioactive nucleotide should you use to follow chain elongation?

Part 4. Putting It Together 1) Consider the diagram below as well as the given information. This diagram represents a piece of circular DNA which was cut in 4 separate reactions (4 different test tubes, each with some of this DNA in it). One digest was done with AvaI, another with ClaI, a third with EcoRV, and a fourth with ScaI. The locations of the recognition sequences for each restriction enzyme are shown along with the location of that site in bp along the circle (it goes clockwise from position 1). You run an agarose gel with a molecular weight marker in the first lane, the AvaI digest in lane 2, the ClaI digest in lane 3, the EcoRV digest in lane 4, and the ScaI digest in lane 5. a) Use the space below and draw out the agarose gel described above. Use your drawing to answer the next questions. b) How many bands of DNA are there in lane 3? c) How many bands of DNA are there in lane 5? d) There would be 2 bands of DNA in lane 4. How big are they? e) Which lane…

Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…