Concept explainers
Interpretation:
The experiments that needs to be designed to determine the factors affecting the DNA double helix structural stability needs to be explained.
Concept introduction:
The stability of a DNA double helical structure depends on the hydrogen bonding between bases and base-stacking interaction between adjacent bases.
The bases present in a single strand of DNA have polar amido, amidino, guanidino and carbonyl groups which form hydrogen bonds with water, but when the double helical structure is formed some of the bond breaks as the bases combine to form inter-base hydrogen bonds. The change in enthalpy, in this case, is due to the difference of energy in the new hydrogen bond formed and old hydrogen bond is broken.
The stability of base stacks of the double helix depends on the DNA sequence. Some sequences are more stable than others, hence the nearest base stack is important to state the stability of the double helical structure.
Want to see the full answer?
Check out a sample textbook solutionChapter 4 Solutions
BIOCHEMISTRY-ACHIEVE (1 TERM)
- The Tm of a DNA strand can be calculated by hand using the formula: (2 ℃)(?????? ?? ? + ?) + (4 ℃)(?????? ?? ? + ?) = ??℃ Using this formular, calculate the Tm for the following DNA sequence: [CTTTCACAGCCACTATCCAGCGGTAC] Note: This formula has several limitations and is not useful for sequences longer than 14 bp. Use the Internet search to find an online Tm calculator. Use this calculator to find the Tm of the above sequence. Using information from your search, identify three factors that can affect the Tm.arrow_forwardDNA helicases are involved in diverse cellular processes. List four examples of DNA helicases that we discussed in this class and describe their specific activities in the examples you list.arrow_forwardEthanol promotes bonding between Na+ ions from the salt and charged phosphate group of the DNA due to a higher dielectric constant than water. True or False?arrow_forward
- You're purifying some plasmid DNA from a culture of bacteria and you want to know how pure it is. You measure the optical density at 260 m and 280 m and find the ratio is 2.0. You suspect there is RNA contamination in your preparation, so you treat your preparation with RNase. But the ratio is still 2.0. Protein assays tell you there is no protein in your solution, and no other biological molecules absorb light very efficiently at those wavelengths. What's the explanation?arrow_forwardYou're purifying some plasmid DNA from a culture of bacteria and you want to know how pure it is. You measure the optical density at 260 nm and 280 nm and find the ratio is 2.0. You suspect there is RNA contamination in your preparation, so you treat your preparation with RNase. But the ratio is still 2.0. Protein assays tell you there is no protein in your solution, and no other biological molecules absorb light very efficiently at those wavelengths. What's the explanation?arrow_forwardA plot showing the % of denaturation as a function of temperature for a melting point of a DNA sample under 0.12 M NaCl gives an equation of a line of Y= 0.0074 X - 0.044. (where Y is the % of denaturation and X is the temperature in °C) Question: Calculate the melting point of this DNA in °C.arrow_forward
- Please give me correct solution for both questions c and d.arrow_forwardDoes the Hershy-Chase experiment distinguish between DNA and RNA as the molecular serving as the genetic material? Why or why not?arrow_forwardIn Polymerase Chain Reaction (PCR), the temperature is one of the most important parameters that could influence the efficiency of this technique. Each cycle of this reaction has its own specific temperature. For instance, the denaturation step possesses a temperature of 94 - 98 ℃ to ensure that the double stranded DNA is fully separated. (i) (ii) (iii) Why is the annealing temperature vital in this technique? Explain how will this temperature affects the efficiency of this reaction. Why is Hot Start PCR technique preferred by some researchers? If the primers you purchased possessed the following information. 5'-GGA AAC AGC TAT GAC CAT G-3' Calculate the melting temperature of this primer and estimate the annealing temperature of this primer.arrow_forward
- A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) isconstructed, will its melting temperature be higher or lower?arrow_forwardThe two sides of the DNA double helix are connected by pairs of bases (adenine, thymine, cytosine, and guanine). Because of the geometric shape of these molecules, adenine bonds with thymine and cytosine bonds with guanine. The figure (Figure 1) shows the thymine-adenine bond. Each charge shown is ±e, and the H−N distance is 0.110 nm . Calculate the net force that thymine exerts on adenine. To keep the calculations fairly simple, yet reasonable, consider only the forces due to the O−H−N and the N−H−N combinations, assuming that these two combinations are parallel to each other. Remember, however, that in the O−H−N set, the O− exerts a force on both the H+ and the N−, and likewise along the N−H−N set. Express your answer in newtons. Is the net force attractive or repulsive?arrow_forwardThe melting temperature Tm of DNA can be predicted by calculation without actually measuring it. Calculate the Tm of the DNA double strand shown in (1) to (3), and discuss the results. The numbers in parentheses indicate the degree of polymerization of nucleotides.(1) A(10) + T(10), (2) A(15) + T(15), (3) G(10) + C(10)arrow_forward
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning