BIOCHEMISTRY-ACHIEVE (1 TERM)
9th Edition
ISBN: 9781319402853
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 4, Problem 35P
Interpretation Introduction
Interpretation:
The term consensus sequence needs to be explained.
Concept introduction:
When number of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Proteins called molecular chaperones assist in the process of protein folding. One class of chaperones found in organisms
from bacteria to mammals is heat shock protein 90 (Hsp90). All Hsp90 chaperones contain a 10 amino acid signature
sequence that readily allows identification of these proteins in sequence databases.
Two representations of the Hsp90 signature sequence are shown here.
Y-x-[NQHD]-[KHR]-[DE]-[IVA]-F-[LM]-R-[ED].
4
YSNKE/FLRE
3.
7.
1
1 2 3 4 5 6 7 8 9 10
C
Bits
. What is a consensus sequence?
. The genetic code is thought to have evolved to maximize genetic stability
by minimizing the effect on protein function of most substitution muta-
tions (single-base changes). We will use the six arginine codons to test this
idea. Consider all of the substitutions that could affect all of the six arginine
codons.
(a) How many total mutations are possible?
(b) How many of these mutations are "silent," in the sense that the mutant
codon is changed to another Arg codon?
(c) How many of these mutations are conservative, in the sense that an Arg
codon is changed to a functionally similar Lys codon?
Chapter 4 Solutions
BIOCHEMISTRY-ACHIEVE (1 TERM)
Ch. 4 - Prob. 1PCh. 4 - Prob. 2PCh. 4 - Prob. 3PCh. 4 - Prob. 4PCh. 4 - Prob. 5PCh. 4 - Prob. 6PCh. 4 - Prob. 7PCh. 4 - Prob. 8PCh. 4 - Prob. 9PCh. 4 - Prob. 10P
Ch. 4 - Prob. 11PCh. 4 - Prob. 12PCh. 4 - Prob. 13PCh. 4 - Prob. 14PCh. 4 - Prob. 15PCh. 4 - Prob. 16PCh. 4 - Prob. 17PCh. 4 - Prob. 18PCh. 4 - Prob. 19PCh. 4 - Prob. 20PCh. 4 - Prob. 21PCh. 4 - Prob. 22PCh. 4 - Prob. 23PCh. 4 - Prob. 24PCh. 4 - Prob. 25PCh. 4 - Prob. 26PCh. 4 - Prob. 27PCh. 4 - Prob. 28PCh. 4 - Prob. 29PCh. 4 - Prob. 30PCh. 4 - Prob. 31PCh. 4 - Prob. 32PCh. 4 - Prob. 33PCh. 4 - Prob. 34PCh. 4 - Prob. 35PCh. 4 - Prob. 36PCh. 4 - Prob. 37PCh. 4 - Prob. 38PCh. 4 - Prob. 39PCh. 4 - Prob. 40PCh. 4 - Prob. 41PCh. 4 - Prob. 42PCh. 4 - Prob. 43PCh. 4 - Prob. 44PCh. 4 - Prob. 45PCh. 4 - Prob. 46PCh. 4 - Prob. 47PCh. 4 - Prob. 48PCh. 4 - Prob. 49PCh. 4 - Prob. 50PCh. 4 - Prob. 51PCh. 4 - Prob. 52P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Remember remove the introns! All introns start with GT and end with AG.arrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forwardThe subunits of the translation initiation complex in PROKARYOTES.* 1 point O 30S and 50S O 40S and 60S O 20S and 60S O 10S and 70S Normal pH of the human blood? * 1 point O 7.30 to 7.40 O 7.35 to 7.45 O 7.40 to 7.50 O 7.45 to 7.55 A structural motif that contains 2 cysteine and 2 histidine amino acids. * I point Helix-turn-helix Motifarrow_forward
- . The following synthetic polynucleotide is synthesized and used as a template for peptide synthesis in a cell-free system from E. coli. .AUAUAUAUAUAUAU-. What polypeptide would you expect to be produced? Precisely what information would this give you about the code?arrow_forwardThe following polynucleotide was synthesized and used as a template forpeptide synthesis in a cell-free system from E. coli. …AUAUAUAUAUAUAU…What polypeptide would you expect to be produced? What informationwould this give you about the code?arrow_forwardPlease do answer all the questions. I'll definitely give a like You discovered a halophilic bacterium and want to characterize the mechanism involved in producing mature tRNA molecules from larger tRNA precursors. You isolated a large complex composed of a protein component and an RNA component that is capable of cleaving the larger tRNA precursor. To determine which one of the two components is responsible for catalysis, you perform an in vitro tRNA cleavage assay in the proper buffer conditions, including a low concentration of Mg2+ and 0.5 M bovine serum albumin (BSA). BSA is not specific for this reaction. The table below summarizes the results after performing eight separate reactions. The + symbol indicates the included reaction components. Q. Based on the results obtained, what can you conclude about the composition of the biological catalyst required for the maturation of tRNA? Q. Indicate which reactions helped you make your conclusion. Why? Q. Which reactions allowed you…arrow_forward
- Open reading frames... correspond to introns, which are not read by the ribosome during translation correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in a particular frame correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in any of six frames are often rich in acetylated histones which allow transcription occur when fragments of DNA sequence are highly similar between two species are recognized by ribosomes to initiate translationarrow_forwardThe Shine-Dalgarno Sequence is used in bacteria eukaryotes botharrow_forwardIn describing the triplet binding assay, an undergraduate with limited knowledge of translation might say, “That should not work.” That statement makes sense. Explain why, and describe how researchers successfully performed this assay.arrow_forward
- Let’s suppose a DNA mutation changes the consensus sequence at the −35 site in a way that inhibits σ factor binding. Explain how a mutation could inhibit the binding of σ factor to the DNA. Describe two specific base substitutions you think would inhibit the binding of σ factor. Explain why your base substitutions would have this effect.arrow_forwardAAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene? (Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.) Submit Answer Retry Entire Group No more group attempts remainarrow_forward. What is the biological benefit of a degenerate genetic code?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY