Pearson eText for Biochemistry: Concepts and Connections -- Instant Access (Pearson+)
2nd Edition
ISBN: 9780137533114
Author: Dean Appling, Spencer Anthony-Cahill
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 4, Problem 7P
For some DNAs, it is possible to separate the two strands, after denaturation, in a CsCl gradient.
a. What property of any DNA determines where it will band in a CsCl?
b. What kind of DNA might have two strands that differ sufficiently in this property that they could be separated after denaturation?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
For some DNAs, it is possible to separate the two strands, after denaturation,in a CsCl gradient.(a) What property of any DNA determines where it will band in a CsClgradient?(b) What kind of DNA might have two strands that differ sufficiently in thisproperty that they could be separated after denaturation?
Suppose the following base sequence was found in a 20-base DNA polymer.
3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5'
a. What would be the first 5 bases at the 3' end of the complementary strand?
b. What would be the first 10 bases at the 5' end of the complementary
strand?
c. Assuming the presence of the complementary strand, what is the
percentage composition of the polymer with respect to the A-T base pair?
with respect to the G-C base pair?
d. In the given segment in problem 1, illustrate and indicate the direction of the
synthesis of:
i. a 5-nucleotide RNA primer
ii. a 5-nucleotide Okazaki fragment
Do any strands of nucleic acid exist in nature in which part of the strand is DNA and part is RNA? If so, a.describe when such strands of nucleic acid are synthesized. Is the RNA component at the 5' end or at the 3' end?
Chapter 4 Solutions
Pearson eText for Biochemistry: Concepts and Connections -- Instant Access (Pearson+)
Ch. 4 - Prob. 1PCh. 4 - What is the difference between a nucleoside...Ch. 4 - pppApCpCpupApGpApu-OH a. Using the straight-chain...Ch. 4 - Shown is a representation of a molecule being...Ch. 4 - Base analysis of DNA from maize (com) shows it to...Ch. 4 - Using the pKa data in Table 4.1 and the...Ch. 4 - For some DNAs, it is possible to separate the two...Ch. 4 - Refer to Figure 4.15, which presents the...Ch. 4 - Suppose that you centrifuged a transfer RNA...Ch. 4 - Predict the structure of a cruciform that could be...
Ch. 4 - DNA from a newly discovered virus was purified,...Ch. 4 - Would you expect Neurospora crassa DNA to have a...Ch. 4 - A circular double-stranded DNA molecule contains...Ch. 4 - The gel electrophoresis pattern in Figure 4.23 was...Ch. 4 - 15. DNA polymerase requires both a template, to be...Ch. 4 - Prob. 16PCh. 4 - Prob. 17PCh. 4 - a. What two enthalpic factors stabilize DNA in...Ch. 4 - 19.
a. The plasmid pBR322 (4362 base pairs) was...Ch. 4 - Prob. 20PCh. 4 - What DNA sequence feature is required for a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Explain how DNA-binding proteins can make sequence-specific contacts to a double-stranded DNA molecule without breaking the hydrogen bonds that hold the bases together. indicate how, through such contacts, a protein can distinguish a T-A from a C-G pair. indicate the parts of the nucleotide base pairs that could form noncovalent interactions— hydrogen bonds, electrostatic attractions, or hydrophobic interactions -with a DNA-binding protein.arrow_forwardEthanol promotes bonding between Na+ ions from the salt and charged phosphate group of the DNA due to a higher dielectric constant than water. True or False?arrow_forwardThe complementary strands of DNA in the double helixare held together by hydrogen bonds: G ≡ C or A = T.These bonds can be broken (denatured) in aqueous solutions by heating to yield two single strands of DNA(see Figure 1-13a). How would you expect the relativeamounts of GC versus AT base pairs in a DNA doublehelix to affect the amount of heat required to denatureit? How would you expect the length of a DNA doublehelix in base pairs to affect the amount of heat requiredto denature it?arrow_forward
- Assume that a poly(A) tract five base pairs long produces a 20° bend in aDNA strand. Calculate the total (net) bend produced in a DNA if the center base pairs (the third of five) of two successive (dA)5 tracts are located (a) 10 base pairs apart; (b) 15 base pairs apart. Assume 10 base pairs per turn in the DNA double helixarrow_forwardConsider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?arrow_forwardif this DNA has a molecular weight of 1.20 ×108 Dalton which contains a head in a about 200 nm long. Calculate the length of the DNA assuming the molecular weight of a nucleotide pair is 600 Dalton and assume that the DNA is a B-form and that there are 10 base pair per turn which makes is 34 Å per turn. ( 1nm = 10Å)arrow_forward
- The first 15 bases of the original coding informational strand of DNA (which continues after what is shown) are 5-ATGAAACCCGGGTTT(...)-3'. Which of the following mutations to this original strand would be silent and which would likely only have a small effect on the coded protein? (Again, only the first 15 bases of the DNA strand are shown, even though they continue on. HINT: To solve this, you might write out the template DNA strand, the mRNA strand that would be made, and the resulting amino acids for the start of the protein.) Mutation #1: 5-ATGAAAGCCCGGGTT(...)-3' Mutation #2: 5-ATGAACCCCGGGTTT(...)-3' Mutation #3: 5-ATGAACCCGGGTTTA(...)-3' Mutation #4: 5-ATGAAGCCCGGGTTT(...)-3' Mutation #5: 5-ATGTAACCCGGGTTT(...)-3'arrow_forwardThe High Mobility Group (HMG) proteins are architectural regulators of DNA. Many HMG proteins are phosphorylated at certain serine residues. How would phosphorylation change the binding affinity of HMG proteins to DNA?arrow_forwardSupercoiled DNA is slightly unwound compared to relaxed DNA and this enables it to assume a more compact structure with enhanced physical stability. Describe the enzymes that control the number of supercoils present in the E. coli chromosome. How much would you have to reduce the linking number to increase the number of supercoils by five?arrow_forward
- The melting temperature Tm of DNA can be predicted by calculation without actually measuring it. Calculate the Tm of the DNA double strand shown in (1) to (3), and discuss the results. The numbers in parentheses indicate the degree of polymerization of nucleotides.(1) A(10) + T(10), (2) A(15) + T(15), (3) G(10) + C(10)arrow_forwardWhen the helix axis of a closed circular duplex DNA of 2310 bp is constrained to lie in a plane, the DNA has a twist (T) of 207. When released, the DNA takes up its normal twist of 10.5 bp per turn. Indicate the values of the linking number (L), writhing number (W), and twist for both the constrained and unconstrained conformational states of this DNA circle. What is the superhelix density, σ = W/T, of both the constrained and unconstrained DNA circles?arrow_forwardThe cells of many eukaryotic organisms have highly specialized systems that specifically repair G–T mismatches in DNA. The mismatch is repaired to forma G≡C (not A=T) base pair. This G–T mismatch repair mechanism occurs in addition to a more general system that repairs virtually all mismatches. Suggest why cells might require a specialized system to repair G–T mismatches.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license