Gen Combo Ll Biology; Connect W/learnsmart Labs Access Card
4th Edition
ISBN: 9781259853197
Author: Robert Brooker
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 44.3, Problem 1EQ
What is the normal function of the PPAR-δ protein in mice?
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
The lac genotypes are as shown below:
P+OcZ-Y+A+// P¯O+Z+Y+A+
(i)
The lac operon consists of three structural genes, lacZ, lacY and lacA. Which
structural genes are involved in lactose metabolism? Explain.
(ii)
Draw and explain how lactose repress the gene expression in lac IS/I- heterozygote.
(iii)
What is the function of the promoter in the bacterial operon?
How does the HAEIII enzyme discriminate between the C-G polymorphism in the TAS2R38 gene?
Discuss in general terms the principle of the regulation of theexpression of the trp gene with attenuation in bacteria.
Chapter 44 Solutions
Gen Combo Ll Biology; Connect W/learnsmart Labs Access Card
Ch. 44.1 - Prob. 1CCCh. 44.2 - Prob. 1CCCh. 44.2 - Prob. 2CCCh. 44.2 - Prob. 1BCCh. 44.3 - Prob. 1CCCh. 44.3 - Prob. 1BCCh. 44.3 - What is the normal function of the PPAR- protein...Ch. 44.3 - CoreSKILL What was the hypothesis proposed by...Ch. 44.3 - CoreSKILL Assume that the mean weight of both...Ch. 44 - Prob. 1TY
Ch. 44 - Prob. 2TYCh. 44 - Prob. 3TYCh. 44 - Prob. 4TYCh. 44 - The function of ATP during muscle contraction is...Ch. 44 - Prob. 6TYCh. 44 - Stimulation of a muscle fiber by a motor neuron...Ch. 44 - Muscle fibers that have a large number of...Ch. 44 - Which of the following statements about movement...Ch. 44 - Prob. 10TYCh. 44 - Compare the structural and functional features of...Ch. 44 - List and briefly describe the steps in the...Ch. 44 - Prob. 3CQCh. 44 - Describe as many types of animal locomotion as you...Ch. 44 - Discuss the three types of muscle tissues found in...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Gregor Mendel never saw a gene, yet he concluded that some inherited factors were responsible for the patterns ...
Campbell Essential Biology (6th Edition) - standalone book
2. A gene is a segment of DNA that has the information to produce a functional product. The functional product ...
Genetics: Analysis and Principles
The term ‘spore’.
Biology Science Notebook
11. In the early 1800s, French naturalist Jean Baptiste Lamarck suggested that the best explanation for the rel...
Campbell Biology: Concepts & Connections (9th Edition)
a. What three lineages of lobe-fins survive today? b. Go back to the phylogenetic tree in Interactive Question ...
Study Guide for Campbell Biology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- There was a study done (Isabel, et al.) on structural analysis of SARS-CoV-2 spike protein. The researchers hypothesized that a mutation in Asp 614 to Gly 614 will result in a loss of four inter-chain destabilizing (i.e., hydrophobic-hydrophilic) contacts. I attached an image that illustrates this (C). My question is: how does this classify as a repelling effect when Asp 614 should be hydrogen bonding with Thr 859? If Asp 614 is mutated to Gly 614, then wouldn't this hydrogen bonding no longer occur? Just not too sure what this hydrophobic-hydrophilic repelling effect is referring to exactly.arrow_forwardIdentify the ligand that bind to uniprotkb-P39086, the type of allostery, and describe the general function of the proteinarrow_forwardWhat are the primary structures of TATA-binding protein (for ex. letter amino acids), What are the secondary structures of TATA-binding protein (for ex. helices, sheets, etc), What are the tertiary structures of TATA-binding protein? What are the quaternary structures of TATA-binding protein?arrow_forward
- A particular type of anemia in humans, called b-thalassemia,results from a severe reduction or absence of the normal b-globinchain of hemoglobin. However, the g@globin chain, normally onlyexpressed during fetal development, can functionally substitutefor b-globin. A variety of studies have explored the use of thenucleoside 5-azacytidine for the expression of g-globin in adultpatients with b-thalassemia.(a) How might 5-azacytidine lead to expression of g-globin inadult patients?(b) Explain why this drug may also have some adverse side effects.arrow_forwardIn Figure 12-4, certain mutations decrease the relativetranscription rate of the β-globin gene. Where are thesemutations located, and how do they exert their effects ontranscription?arrow_forwardThe protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb. How is thisdifference possible?arrow_forward
- If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individualarrow_forwardConsider the now dominant variant of the SARS-CoV-2 called the D614G mutation: a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________ b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…arrow_forwardATM is a kinase that phosphorylates histone H2AX in response to double-stranded DNA breaks. Which of the following scenarios would most quickly regulate ATM activity in the cell? a) Adding silencing methyl groups to cytosines in the Atm gene b) Modifying the histone code for the Atm gene c) Increasing expression of a miRNA specific for the Atm mRNA d) Activating an E3 ubiquitin ligase specific for the ATM proteinarrow_forward
- A pharmaceutical company developed a drug, CP788, that inhibits the interaction of Grb2 with SH2 domains as a treatment for breast cancer. As the data below shows, the compound inhibits activation of RAS in MDA-MB-468 breast cancer cells (Figure A) and anchorage-dependent growth (Figure B solid line) in MDA-MB-468 breast cancer cells. Note that these experimets were done in the presence of EGF. Briefly explain the steps in the pathway by which inhibition of Grb2/SH2 interaction would inhibit activation of RAS (limit 5-6 sentences). A Inhibition of RAS Activation by CP788 % RAS Activation 120 100 80 60 20 0 0 50 [CP788] UM 100 B Colonies number (% of untreated control) 120 100 80 60 40 20 0 10-² HigHt 10-¹ 10⁰ 10¹ 10² 10³ [CP788] UMarrow_forwardFor the lac genotypes shown in the following table, predict whether the structural genes (Z) are constitutive, permanently repressed, or inducible in the presence of lactose. Genotype Constitutive Repressed Inducible I+O+Z+ * I-O+Z+ I-OCZ+ I-OCZ+/F=O+ I+OCZ+/F=O+ ISO+Z+ ISO+Z+/F=I+arrow_forwardWhat are the major factors in the various mutants of the spike protein?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY