![Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)](https://www.bartleby.com/isbn_cover_images/9780135564172/9780135564172_largeCoverImage.gif)
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
3rd Edition
ISBN: 9780135564172
Author: Mark Sanders, John Bowman
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 5, Problem 11P
The recombination frequency between linked genes is lessthan
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Why is the upper limit of recombination 50% rather than 100%?
The recombination frequency in a cross can never exceed 50%. Explain why is this limit?
Recombination frequency between two linked loci is always less than 0.5 (or 50%). Why?
Chapter 5 Solutions
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
Ch. 5 - For parts a, b, and c, draw a diagram illustrating...Ch. 5 - 5.2 In a diploid species of plant, the genes for...Ch. 5 - A pure-breeding tall plant producing oval fruit as...Ch. 5 - 5.4 Genes E and H are syntenic in an experimental...Ch. 5 - In tomato plants, purple leaf color is controlled...Ch. 5 - 5.6 In Drosophila, the map positions of genes are...Ch. 5 - 5.7 Genes A, B, and C are linked on a chromosome...Ch. 5 - Gene G recombines with gene T at a frequency of...Ch. 5 - Genes A, B, C, D, and E are linked on a...Ch. 5 - Syntenic genes can assort independently. Explain...
Ch. 5 - 5.11 The recombination frequency between linked...Ch. 5 - On the DrosophilaX chromosome, the dominant allele...Ch. 5 - Researchers cross a corn plant that is pure -...Ch. 5 - 5.14 syndrome is an autosomal disorder affecting...Ch. 5 - 5.15 Three dominant traits of corn seedlings,...Ch. 5 - 5.16 In a diploid plant species, an with the...Ch. 5 - Prob. 17PCh. 5 - The Rh blood group in humans is determined by a...Ch. 5 - 5.19 Genetic linkage mapping for a large number of...Ch. 5 - 5.20 with the genotype form tetrads in the...Ch. 5 -
Gene and gene are genetically linked. Answer...Ch. 5 -
T. H. Morgan’s data on eye color and wing form,...Ch. 5 - Prob. 23PCh. 5 -
The boss in your laboratory has just heard of a...Ch. 5 - In rabbits, chocolate-colored fur (w+) is dominant...Ch. 5 - Prob. 26PCh. 5 - 5.27 In tomatoes, the allele for tall plant height...Ch. 5 - 5.28 Neurofibromatosis is an autosomal dominant...Ch. 5 - A 2006 genetic study of a large American family...Ch. 5 - 5.30 A experiment examining potential genetic...Ch. 5 - A genetic study of an early onset form of heart...Ch. 5 - In experiments published in 1918 that sought to...Ch. 5 - DNA sequence for 10 individuals are Identify the...Ch. 5 - 5.34 The accompanying pedigree below shows a...Ch. 5 - 5.35 Based on previous family studies, an...Ch. 5 - Divide a clean sheet of paper into four quadrant...Ch. 5 - 5.37 For six genes known to be linked on chromosme...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- If the genes are not assorting independently, what is the recombinationfrequency between them?arrow_forwardExplain the following pairs of concepts and briefly describe their major difference(s) 1. Recombination fraction & genetic distance.arrow_forwardResearchers have discovered that some regions of chromosomes are more likely than others to cross over, these areas of frequent crossing over are called "recombination hot spots". Gene A and B are 500,000 bp apart - the genes are either side of a recombination hot spot. Gene C and D are also 500,000 bp apart but the region containing genes C and D are not near a recombination hot spot. Would the map distance between A and B be the same as the map distance between C and D? Explain your answer.arrow_forward
- A molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’arrow_forwardWhat does the term recombination mean? What are two causes of recombination?arrow_forwardAn individual is heterozygous for a reciprocal translocation, with the following chromosomes: A • B C D E F A • B C V W X R ST • U D E F R ST • U V W X Q. Draw the products of alternate, adjacent-1, and adjacent-2 segregations.arrow_forward
- Describe two forms of genetic recombination. What functions do they fulfill?arrow_forwardResearchers have discovered that some regions of chromosomes are more likely than others to cross over, these areas of frequent crossing over are called "recombination hot spots". Gene A and B are 500,000 bp apart - both genes and the space between them are in a recombination hot spot. Gene C and D are also 500,000 bp apart but the region containing genes C and D are not a recombination hot spot. Would the map distance between A and B be the same as the map distance between C and D? Explain your answer.arrow_forwardThe recombination frequency between genes a and b is 20%. What is the frequency of crossing over between genes a and b? Explain your reasoning.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
genetic recombination strategies of bacteria CONJUGATION, TRANSDUCTION AND TRANSFORMATION; Author: Scientist Cindy;https://www.youtube.com/watch?v=_Va8FZJEl9A;License: Standard youtube license