BIOCHEMISTRY-ACHIEVE (1 TERM)
9th Edition
ISBN: 9781319402853
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 5, Problem 22P
Interpretation Introduction
Interpretation:
The nature of the amino acid change in the given variants is to be explained.
Concept introduction:
The organic compounds that contain
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Why does a dual layer of Cr/Au (20/100nm) delaminate during a GSTAT electrochemical polymerization of Pedots;pss
Marker Proteins
Molecular Weight (daltons)
Distance
132,000
66,000
43,000
14,400
Serum Albumin (Dimer)
Serum Albumin (Monomer)
23mm
32mm
Ovalbumin
39mm
60mm
Lysozyme
Unknown 1
26mm
Unknown 2
58mm
Rabbit serum (albumin)
33mm
1.On semilog paper (provided below) plot the distance migrated by each standard protein as a
function of molecular weight. Determine the molecular weight of the unknown proteins and the
major protein found in rabbit serum (albumin) from this calibration curve.
ii) Interferon is a protein of 25,000 Dalton. How far would it have migrated, land it been
included in this experiment?
iii) The average amino acid residue in a protein has a molecular weight of 120 Daltons.
Assuming that your unknowns are average, how many amino acid residues do they contain
Which of the peptide sequences below best matches the hydropathy plot shown?
5
10
15
Residue Number
ILYYAGSREDHSGYLIL
EQSDTERNQHGALIYLI
LIFLAIFPAGSTSEDRR
RAFLILFMTYFLILFLI
LHGDQNRERDGHSQERD
2
Hydropathy value
0
-4 -2
Chapter 5 Solutions
BIOCHEMISTRY-ACHIEVE (1 TERM)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Given this: Protein Isoelectric pH Molecular weight (kDa) Ovalbumin 4.6 45 Insulin 5.4 5.7 Fibrinogen 5.8 340 Y-globulin 6.6 160 Collagen 6.6 115 Hemoglobin (monomer) 7.1 16 Myoglobin 7.0 16.7 Does all proteins separated properly w/ 2D gel electrophoresis?arrow_forwardSequence: CCACCTGTACCCGGACACACCCTGGTGTCC What human disease has been connected to this gene? Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.arrow_forward1CFD CALCIUM-FREE CALMODULIN How long is the protein’s primary sequence?Does this protein have any secondary, tertiary and/or quaternary structures present?Are there any molecular additions to this protein that are not amino acarrow_forward
- 2q Which of the peptide sequences below best matches the hydropathy plot shown? 5 10 Residue Number RAFLILFMTYFLILFLI ILYYAGSREDHSGYLIL LHGDQNRERDGHSQERD EQSDTERNQHGALIYLI 3q Which of the peptide sequences below best matches the hydropathy plot shown? 5 10 Residue Number Hydropathy value -4 -2 0 2 4 Hydropathy value -4 -2 ILYYAGSREDHSGYLIL EQSDTERNQHGALIYLI LIFLAIFPAGSTSEDRR RAFLILFMTYFLILFLI L 15 15arrow_forwardTable I CACGT A GA CTGAGG ACTC CACGTAGACTGAG G ACAC Wild-type beta-globin gene fragment Sickle-cell beta-globin gene fragment > Circle the mutation in DNA of the sickle-cell beta-globin gene fragment Compare fragments of DNA the wild-type and mutant beta-globin genes in the Table I above, what are the similarities and differences you observe?arrow_forwardA genetics student was asked to draw the chemical structureof an adenine- and thymine-containing dinucleotide derivedfrom DNA. His answer is shown below. The student made morethan six major errors. One of them is circled, numbered 1, andexplained. Find five others. Circle them, number them 2 to 6, andbriefly explain each by following the attached given.arrow_forward
- Using text, diagrams and'or drawn structures where appropriate, briefly describe how selective depurination (i.e., loss of the base) and cleavage of the 3' and 5' phosphodiester bonds of guanine containing deoxyribonucleotides occurs in the Maxim-Gilbert DNA sequencing method.arrow_forwardGiven: Cryo-EM structure of PCoV_GX spike glycoprotein 1. What can you tell me about the identity of the protein? 2. What is the importance of this protein?arrow_forwardJustify all answers (show all work). 1. Minor changes in primary structure can have pronounced effects on biological function. Tetrameric hemoglobin, a₂³₂, dissociates into pairs of dimers aß to different extents depending on the protein primary structure. The standard Gibb energies of dissociation of normal adult hemoglobin A and of several mutants have been determined and are listed in the table below. Substitution in mutant Hemoglobin A, normal Richmond Kansas Georgia 102B; Asn → Thr 102B; Asn → Thr 95x; Pro → Leu AG® of dissociation (kcal/mole Hb) 8.2 6.0 65 5.1 3.6 (a) Write an equilibrium expression for the dissociation of hemoglobin tetramer into dimers. (b) For normal hemoglobin and its three mutants (variations) calculate the equilibrium constant for their dissociation from a tetramer into dimers. (c) How do the equilibrium constants for the dissociation of the hemoglobin mutants compare to that of normal hemoglobin?arrow_forward
- Which of the peptide sequences below best matches the hydropathy plot shown? L 10 Residue Number 4 2 Hydropathy value -2 0 セー RAFLILFMTYFLILFLI ILYYAGSREDHSGYLIL OLHGDQNRERDGHSQERD EQSDTERNQHGALIYLI 01 5 15arrow_forwardGT 3 A. Write the structure of the pentapeptide GLDSC. B. What is the complete name of this pentapeptide? 1. Show a tertiary structure of ACGGC after a disulfide bond forms. A sample of an unknown peptide was divided into two aliquots. One aliquot was treated with trypsin; the other was treated with cyanogen bromide. Given the following sequences (N-terminal to C-terminal) of the resulting fragments, deduce the sequence of the original peptide. 2. 3. Trypsin treatment Asn-Thr-Trp-Met-lle-Lys Gly-Tyr-Met-GIn-Phe Val-Leu-Gly-Met-Ser-Arg Cyanogen bromide treatment Gln-Phe Val-Leu-Gly-Met lle-Lys-Gly-Tyr-Met Ser-Arg-Asn-Thr-Trp-Metarrow_forward[protein] volume [protein] [protein] in to Sample Lysate in "gel- load 5 in 20 protein in Name volume assay* lysate ready" ul sample protein 3.9 2 µl Hg/ml Tilapia 19.9 10 μι Hg/ml 18.2 2 µl Hg/ml Cod >20 14 10 μι Hg/ml 9.4 15 2 µl ug/ml Sole >20 6. 10 μι ug/ml > >arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License