![Pearson eText for Biochemistry: Concepts and Connections -- Instant Access (Pearson+)](https://www.bartleby.com/isbn_cover_images/9780137533114/9780137533114_largeCoverImage.gif)
Pearson eText for Biochemistry: Concepts and Connections -- Instant Access (Pearson+)
2nd Edition
ISBN: 9780137533114
Author: Dean Appling, Spencer Anthony-Cahill
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 5, Problem 23P
If you want to purify a DNA-binding protein from a crude mixture of proteins at pH 7, should you use a DEAE-cellulose or a CM-cellulose column (see Figure 5.A5)? Briefly explain your reasoning.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Each group will be provided with 20 g double-stranded DNA oligomer in STE buffer (0.1M NaCl/ Tris/ 10 mM EDTA, pH 7.4). The sequence of one strand of the oligomer is:
5’-AATGGTACGTATACTTTAT-3’
- show a table of % denaturation of DNA at different temperatures, using the equation provided in “Calculation”
- plot a graph of % denaturation of DNA vs different temperatures with clear label and title, and hence determine the experimental Tm of the DNA sample
- calculate the theoretical Tm of the sample using Marmur and Doty equation, compare the
experimental Tm with theoretical Tm of the DNA sample
You want to treat 10 mL of HL-60 cells with cycloheximide in order to determine the half-life of a newly discovered protein. In order to do this, the final concentration of cycloheximide needs to be 90 µM. How much of a 150 mM stock solution of cycloheximide should you add to your cells?
Consider the proteins in Figure 1. Assume they are treated with chymotrypsin to cut them into fragments, and then the fragments are separated by gel electrophoresis. What would the fragment patterns look like in the gel for the three different proteins, assuming we can separate polypeptides that differ in size by very small amounts? Complete Figure 2 below to show the location of the uncut polypeptides (- enzyme lanes) and the cut fragments (+ enzyme lanes).
Chapter 5 Solutions
Pearson eText for Biochemistry: Concepts and Connections -- Instant Access (Pearson+)
Ch. 5 - Prob. 1PCh. 5 - Draw the structure of the peptide DTLH, showing...Ch. 5 - Prob. 3PCh. 5 - Prob. 4PCh. 5 - Prob. 5PCh. 5 - Prob. 6PCh. 5 - Prob. 7PCh. 5 - Given the following peptide SEPIMAPVEYPK a....Ch. 5 - A mutant form of polypeptide hormone angiotensin...Ch. 5 - Prob. 10P
Ch. 5 - Prob. 11PCh. 5 - a. Write a possible sequence for an mRNA segment...Ch. 5 - 13. Assume the following portion of an mRNA Find a...Ch. 5 - Prob. 14PCh. 5 - Prob. 15PCh. 5 - Prob. 16PCh. 5 - Prob. 17PCh. 5 - Prob. 18PCh. 5 - You are a summer intern in a clinical hematology...Ch. 5 - Prob. 20PCh. 5 - Despite the fact that many peptides have critical...Ch. 5 - Based on the information in Figure 5.17, which...Ch. 5 - If you want to purify a DNA-binding protein from a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Suppose you have two genetic variants of a large protein that differ only inthat one contains a histidine (side chain pKa = 6.0) when the other has avaline (uncharged side chain).(a) Which would be better for separation: gel electrophoresis or isoelectricfocusing? Why?(b) What pH would you choose for the separation?arrow_forwardYou are performing an enzymatic reaction to digest DNA and nothing is working.The working solution for the digestion buffer should contain 400 mM Tris, pH 8.0 and 125 mM MgCl2. Mixed are: 0.2 ml of 2M Tris, pH 8.0 stock solution 0.25 ml of 5M MgCl2 stock solution *Solution completed with 0.55 ml water to make a final volume of 1ml. a) Before checking the calculation, what important question do you have to ask first for this specific solution? (not a generic question about all solutions) b) You are satisfied with the answer to a) and you believe he made a dilution error. You use the equation that applies to dilutions to check his calculations. Aha! you find the problem. What is it and how did you find out?arrow_forwardYou have begun your career in medicinal biochemistry and have just discovered a bacterial DNA plasmld (transferabl ring of DNA) that appears to destroy the Ebola virus. In order to characterize your new plasmid, the molar mass of the plasmid must be determined. You dissolve 25.00 mg of the purified plasmid in 0.200 mL of water at 2 °C and find the osmotlc pressure of this solution is 1.20 Torr at 20 °C and 1 atm pressure. Answer the following about the Ebola-killing plasmid. 33.) The osmotlc pressure of the system is: (a) 1 atm (b) 0.016 atm (c) 6.5 X 10-5 atm (d) 22.59 atm (e) 0.0016 atmarrow_forward
- Spectroscopy is a useful tool to determine the concentration of DNA in a solution by measuring the UV absorbance at a wavelength of 260nm. When analyzing the purity of a DNA sample, an additional measurement of UV absorbance at 280nm is often taken to determine if proteins are is present as well. The ratio of 260/280 is then taken, and the closer this value is to 2 the more pure your DNA sample.a) Given that the aromatic rings present in the nitrogenous bases of DNA cause DNA to absorb UV light at 260nm, predict what might be responsible for proteins absorbing UV light at 280nm.b) You purify two DNA samples and measure the absorbance at 260nm and 280nm. For the first sample (Sample A) the absorbance at 280nm is 0, and for the second sample (Sample B) the absorbance at 260nm is 0.5. You are skeptical that Sample A is really that pure, and upon further testing you identify contaminating protein sequences (shown below) in both samples! Sample A contaminating protein: MSTSILEGAASTLSample B…arrow_forwardYou wish to purify a 55 kDa protein, but it is currently present as a mixture with another protein of approximately the same size. Briefly explain a purification strategy that you could use that would enable you to separate the two proteins.arrow_forwardThe following proteins were separated by SDS-PAGE in the presence of mercaptoethanol. Sketch the relative positions of the various polypeptides on the gel. Label the positive and negative ends of the gel.Protein A: 40 kDa single polypeptideProtein B: 80 kDa protein, made up of two subunits of molecular weight 20 kDa and 60 kDa, held together by noncovalent interactionsProtein C: 200 kDa protein, made up of four identical subunits (50 kDa each) linked together by disulfide bondsarrow_forward
- The OXA-M290 protein is next purified by size exclusion chromatography. To determine the best type of size exclusion resin to use, the size of OXA-M290 must first be determined. Earlier, you determined the amino acid sequence of OXA-M290 (MRVLALSAVFLVASIIGMPAVAKEWQENKSWNAHFTEHKSQGVVVLWNENKQQGFTNNLKRANQAFLPASSAKIPNSLIALDLGVVKDEHQVFKWDGQTRDIATWNRDHNLITAMKYSVVPVYQEFARQIGEARMSKMLHAFDYGNEDISGNVDSFWLDGGIRISATEQISFLRKLYHNKLHVSERSQRIVKQAMLTEANGDYIIRAKTGYDTKIGWWVGWVELDDNVWFFAMNMDMPTSDGLGLRQAITKEVLKQEKIIP). Based on the amino acid sequence, what is the molecular weight of this protein? You can use the free ProtParam tool (https://web.expasy.org/protparam/) to calculate the molecular weights of proteins. Make sure to include units in your answer. Note: The amino acid sequence reported earlier does not include the His-tag that was added to OXA-M290 by the pET-28a vector. However, you do not need to consider the amino acids in the His-tag in your answer to this question. For Context ONLY: For…arrow_forwardGiven the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).2.2. Describe what are missense mutations and its effects on structure and function using haemoglobin as an examplearrow_forward(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21arrow_forward
- Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. (32) (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D). 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’arrow_forwardDraw a structural formula for a nucleoside composed of the following. Q.) b-2-Deoxy-d-ribose and cytosinearrow_forwardAs described in the figure below, the technique of ultracentrifugation can be used to demonstrate whether a substance is composed of large covalently linked molecules, or smaller molecules held together in a complex by noncovalent bonds. You are studying two substances that both have very high molecular weights: hyaluronan, a carbohydrate found in the extracellular matrix with a MW of ~8 x 106 daltons, and the bacterial ribosome, with a MW of -2.5 x 106. Hyaluronan is a single, long-chain polymer, while the ribosome subunit is a complex of 55 different proteins plus three long RNA molecules. Which of the following describes the pattern you would expect to see from ultracentrifugation of these two substances? the sample loaded as a narrow band at the top of the tube (A) sample CENTRIFUGATION stabilizing sucrose gradient tube heterogeneous aggregates would sediment to produce a diffuse smear hemoglobin protein sediments as a single bandarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781319114671/9781319114671_smallCoverImage.jpg)
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
![Text book image](https://www.bartleby.com/isbn_cover_images/9781464126116/9781464126116_smallCoverImage.gif)
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
![Text book image](https://www.bartleby.com/isbn_cover_images/9781118918401/9781118918401_smallCoverImage.gif)
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134015187/9780134015187_smallCoverImage.gif)
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license