BIOCHEM-ACHIEVE(FIRST DAY DISCOUNTED)
9th Edition
ISBN: 2818000069358
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 5, Problem 3P
Interpretation Introduction
Interpretation:
The average distance between the cleave sites for the given enzymes AluI and NotI on digestion of double stranded DNA is to be stated.
Concept introduction:
The restriction enzymes are generated mostly by the bacteria. In the formation of recombinant DNA, the restriction enzymes are involved to cut the particular region in the DNA molecule. This region is known as restriction site.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
gene. If the JM109 strain is transformed by the PBKSK plasmid, the strain will produce the B-galactosidase (from the lac gene)
and will hydrolyze X-gal to produce the blue compound. Therefore, colonies that were transformed and contain the pBSKS wil
you
appear blue.
IPTG &
X-Gal &
NO colonies
Amp
E. coli JM109
E. coli JM109
50 mM calcium
chloride-15% glycerol
lac
lac
lac
IPTG &
I Recovery
X-Gal
solution at -702C
PBSKS
White colonies
E. coli JM109
E. coli JM109
ampR
amp I
amp
lac
lac
Heat Shock
Non-transformed
42°C
E. coli JM109
E. coli JM109
amps
amps
lac
lac
IPTG &
X-Gal
lac I
Recovery
lac
PBSKS
BLUE colonies
PBSKS
ampRI
(amp
Transformed
IPTG &
X-Gal &
BLUE colonies
Amp
Hypotheses: Circle the correct answer
1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin.
a. Why?
_
2. If PBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B-
galactosidase enzyme.
a. Why?_
3. If…
Please help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5
determine what amino acid will be formed from the given DNA strand below:
3’ T A C A T G C C G A A T G C C 5’
Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain.
1. Partner DNA strand
2. the mRNA strand
3. The tRNA
4. the formed amino acids
5. the discussion of the entire procedure
Pstl.
EcoRI
Origin of
replication
(ori)
Ampicillin Tetracycline
resistance resistance
(Amp) (Tet")
pBR322
(4,361 bp)
BamHI
Pvull
Sall
Recombinant
Plasmid DNA
Bacterial cell contains...
No plasmid DNA
pBR322 (no insert)
Recombinant plasmid
00,000.
Host DNA
Transformation
of E. coli cells
+AMP plate
pBR322
Figure 7-5
+TET plate
Based on the recombinant plasmid growth pattern (bottom row of blue table), which of
the depicted plasmid's restriction sites was used to prepare this sample? Explain how
you can tell.
Chapter 5 Solutions
BIOCHEM-ACHIEVE(FIRST DAY DISCOUNTED)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Tyr- The starting substrate and active site of a Type I topoisomerase is shown below. During this reaction, a small molecule is introduced that removes free hydroxyl groups from DNA (but not protein). Please draw the resulting product under these conditions, including the arrow pushing mechanisms that lead to the product(s). s' CH₂ DNA Base O 111110 H CH₂ Basearrow_forwardRNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.arrow_forwardRestriction sites of Lambda (A) DNA - In base pairs (bp) The sites at which each of the 3 different enzymes will cut the same strand of lambda DNA are shown in the maps (see figure 3 B-D), each vertical line on the map is where the respective enzymes will cut. A DNA A (bp) 48502 10 000 20 000 30 000 40 000 9162 17 198 B Sal I 7059 14 885 28 338 35 603 42 900 (bp) Hae III 11 826 21 935 29 341 38 016 (bp) 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864 Figure 3: Restrictrion site map showing the following A) inear DNA that is not cut as reference B) DNA CLt with Sal L C) DNA cut with Hae , D) DNA cut with Eco RI 1. Calculate the size of the resulting fragments as they will occur after digestion and write the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp (see figure 3A). Page 3 of 7 9162 17 198 Sal i (bp) 7059 14 885 28 338 35 603 42 900 Hae I (bp) 11 826 21 935 29 341 38 016 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864arrow_forward
- please help me with thi question. What advantages do CRISPR‑Cas systems have over restriction enzymes and engineered nucleases for editing DNA? The options are attached. Multiple answers can be chosenarrow_forwardQuestion. What would the forward primer sequence look like if it were intended to bind the area of the DNA template?arrow_forwardClose contact. Examination of the structure of DNA polymerases bound to nucleotide analogs reveals that conserved residues come within van der Waals contact of C-2'C-2' of the bound nucleotide. What is the potential significance of this interaction?arrow_forward
- True or False. Just write T if it is true and F if it is false. In E. coli both RNA and protein synthesis take place in the cytoplasm. Okazaki fragments are ssDNA CHAINS OF 100-200 nucleotides long, primed by very short RNA primers in bacteria. In eukaryotic gene, the coding sequences are known as introns while the intervening sequences are the exons. The central dogma refers to the fact that proteins are products of information encoded in RNA using a DNA intermediate. The ends of the linear chromosomes are maintained by telomerase to prevent it from shortening during mitosis. The Shine Delgarno sequence is where the RNA pol binds during transcription in prokaryotes The sigma subunit of the E. coli RNA polymerase confers specificity to transcription. Both DNA replication and transcription follow a 5’ to 3’ direction of polarity. Nucleosomes are the structural unit of chromatin. In the lagging strand, the enzyme X removes RNA primers attached by PRIMASE and this gap is then filled…arrow_forwardorganisms ha varieties. Through this process, several genetically (10) been produced. What I Can Do Activity 7: MATCHY MATCHY Direction: Match the purpose to the components found in the box below. Antibiotic Resistance Gene Multiple Cloning Site Promoter DNA Inserted Gene Sequence Multiple Cloning Site 1. Allows the controlled expression of the desired gene in the presence of an inducing agent (e.g., beta-galactosidase; heat treatment (~65°"C) 2. DNA sequence or portion for the insertion of the desired gene. This section may contain sequences that will be cut by specific restriction endonucleases ( cuts within the molecule) 3. Successful insertion of a gene allows the expression of its protein product. This usually provides a specific trait to the "transformed" bacteria. 4. Provides a way to screen a population of bacteria for those that took up the plasmid. For example, if an ampicillin resistance gene is encoded in the plasmid, then only bacteria 10 t4arrow_forwardTrue or False. Topoisomerase I does not require ATP to break and rejoin DNA strands because the energy of the phospho-diester bond is stored transiently in a phospho-tyrosine linkage in the enzyme’s active site. Explain your answer in 2-3 sentences.arrow_forward
- An extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.arrow_forwardRestriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is shown below. Draw a complementary DNA strand and show the restriction digestion pattern of the double-stranded DNA with BamHI and Pst1. Show the separation pattern of the undigested and the digested DNA on your agarose gel. Label the gel appropriately. 5’ – CGAGCATTTGGATCCTGTGCAATCTGCAGTGCGAT – 3’arrow_forwardPick a plasmid . What was its approximate transformation? Express it in # colonies per microgram of DNA transformed. Assume the original DNA was about .001 ug/ul . Count how many colonies you got on one plate (or estimate that number) and figure out how much of the total solution you plated on that plate. Multiply by all the plates, if you plated all of it. OR, if you only plated some of it, figure out how many colonies you would have gotten had you plated all of it. Divide by the number of ug used.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license