BIOCHEM-ACHIEVE(FIRST DAY DISCOUNTED)
9th Edition
ISBN: 2818000069358
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 5, Problem 9P
]
Interpretation Introduction
Interpretation:
The question that can be asked to determine about the DNA of dinosaur has to be stated.
Concept introduction:
DNA stands for deoxyribonucleic acid, is a biological macromolecule. DNA contains double helical strands along with the complementary base pairs. The four complementary bases of DNA are adenine (A), thymine (T), guanine (G) and cytosine (C).
The reaction that is used to make the duplicates of a particular DNA segment is known polymerase chain reaction (PCR).
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
This is DWA.
You hope to clone an extinct animal species by taking the easy route - using museum bones or
tissues. You extract the DNA and use PCR to amplify, then sequence all segments of the genome
You are unsuccessful. Later you discover that the museum specimens have been treated with
formaldehyde, which forms covalent bonds in DNA, where once there existed H-bonds.
What step in your PCR reaction would be inhibited?
g
-S
Knowing this, if a human was exposed to formaldehyde, what enzyme(s) of DNA
replication in vivo would be prevented from doing their job?
True or False. During gel electrophoresis, small DNA fragments are found towards the top of the gel
True
False
True or False. Each time the genome is replicated, half the newly synthesized DNA is stitched together from Okazaki fragments. Explain your answer in 1-2 sentences.
Chapter 5 Solutions
BIOCHEM-ACHIEVE(FIRST DAY DISCOUNTED)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- true or false. if microbe A or microbe B have the whole genome similarity of 68% as determined by DNA-DNA hybridazation, they should be considered the same species. motivate your answerarrow_forwardplease help me with this question. As this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide two diagrams to illustrate the two potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.arrow_forwardYou have another circular plasmid. Complete and effective digestion of this plasmid with a restriction enzyme yields three bands: 4kb, 2kb, and 1 kb. In comparing the band intensity on an ethidium bromide-stained gel, you notice that the 4 kb and the 2 kb bands have the exact same brightness. The 1 kb band is exactly one fourth as bright as each of these. (Assume there is uniform staining with ethidium bromide throughout the gel.) How many times did the enzyme cut the plasmid? What is the size of the plasmid? Justify your answers to a and b above using a clearly labeled diagram showing the relative location of the cut-sites on the plasmid.arrow_forward
- Why DNA melting is required in PCR? Briefly explain how PCR can be used to detect DNA mutation.arrow_forwardelearn.squ.edu.om/mod/qu NG SYSTEM (ACADEMIC) Time left 0:44:39 If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. GCGCGCGCGCGCGCGCGCGCG O b. GGGGGCCCCCAATTCCCCCCC O c. AAAAAATTTTTCCCCCGGGGG O d. TACTACACTGTGGTTAATTAAA O e. ATATATATCGCGTTAAATTCTA CLEAR MY CHOICE Match the given words with the most suitable words from the given list. Unicellular fungi Hyphae Choose..arrow_forwardPlease answer this asap. Thanks, You have discovered a new plasmid RK21 in a unique bacterial community. As a first step towardunderstanding this plasmid, you digest the plasmid with three restriction enzymes: SspI, XhoI andSmaI. You run the digested plasmid DNA on an agarose gel, along with an uncut sample of theRK21 plasmid DNA as a control.Unfortunately you forget to load a DNA ladder, and obtain the following results. Assumecomplete digestion of all samples or all the digests worked completelyarrow_forward
- In DNA extracting. What is the purpose of clear shampoo in the DNA extraction buffer?arrow_forwardPstl. EcoRI Origin of replication (ori) Ampicillin Tetracycline resistance resistance (Amp) (Tet") pBR322 (4,361 bp) BamHI Pvull Sall Recombinant Plasmid DNA Bacterial cell contains... No plasmid DNA pBR322 (no insert) Recombinant plasmid 00,000. Host DNA Transformation of E. coli cells +AMP plate pBR322 Figure 7-5 +TET plate Based on the recombinant plasmid growth pattern (bottom row of blue table), which of the depicted plasmid's restriction sites was used to prepare this sample? Explain how you can tell.arrow_forwardPlease help me with this please. I really don't know how to make this. I really do appreciate you're help. 1. make a simple illustration to relate the different kinds of DNA to its function.arrow_forward
- gene. If the JM109 strain is transformed by the PBKSK plasmid, the strain will produce the B-galactosidase (from the lac gene) and will hydrolyze X-gal to produce the blue compound. Therefore, colonies that were transformed and contain the pBSKS wil you appear blue. IPTG & X-Gal & NO colonies Amp E. coli JM109 E. coli JM109 50 mM calcium chloride-15% glycerol lac lac lac IPTG & I Recovery X-Gal solution at -702C PBSKS White colonies E. coli JM109 E. coli JM109 ampR amp I amp lac lac Heat Shock Non-transformed 42°C E. coli JM109 E. coli JM109 amps amps lac lac IPTG & X-Gal lac I Recovery lac PBSKS BLUE colonies PBSKS ampRI (amp Transformed IPTG & X-Gal & BLUE colonies Amp Hypotheses: Circle the correct answer 1. If PBSKS is transformed into JM109 cells, colonies will be (able/not able) to grow in the presence of ampicillin. a. Why? _ 2. If PBSKS is transformed into JM109 cells, colonies in media with IPTG (will/will not) induce the production the B- galactosidase enzyme. a. Why?_ 3. If…arrow_forwardule 11 Making Cells – 202 Bb Module 11 Making Cells - 2021 X Bb Take Test: "Lab 11 Homework - X + A sunyocc.open.suny.edu/webapps/assessment/take/launch.jsp?course_assessment_id=_109869_1&course_id=_53817_1&c Question Completion Status: D. Organelle A. Two identical that builds copies of DNA microtubule "highways" to guide DNA B. "staple" that holds DNA copies together C. DNA that is same length and has same instructions; one from mother and one from father Click Save and Submit to save and submit. Click Save All Answers to save all answers. Save All Answers MacBook DD 00 000 F8 F6 F7 F4 F5 F2 F3 F1 * $ % & @ # 2 3 4 * CO < Oarrow_forwardhelping tags: biochemistry, PCR, polymerase chain reaction, PCR cocktail preparation Will upvote, just please help me complete the table and show solutions. Thanks.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305967359/9781305967359_smallCoverImage.gif)
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license