BIOLOGY-TEXT
5th Edition
ISBN: 9781260169621
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 6.2, Problem 1CS
Summary Introduction
To determine: The way in which process of translation would be affected if RNase P does not perform a proper function with reference to the figure 12-20 given in text book.
Introduction: Ribonuclease P is a catalyst that is involved in the processing of transfer RNA (Ribose
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Exercise
In this exercise we will practice transcribing and translating sample DNA. Using your sample DNA,
unzipped and second strand removed, you will first create an RNA strand (transcription). DNA is read in
the 5' → 3' direction, so when you create RNA, a 3'end pairs with the 5' end of DNA. From your RNA
strand, you will need to create codons; remember that a codon is a group of 3 bases that codes for a
specific amino acid. Your codons are read in the 5' → 3' direction (hint: it might be right to left!). You
will then need to convert your codons into amino acids in the 5' → 3' direction (translation).
DNA strand
3' TAC-TTA-CGA-TGG-TAC-ACG-CAA-TCT-ATA-CTC-AAA-TAT-AGG-ACC-TTG-ACG-TCG-AAT-CTC-CAC-TGT-ACC-TTG-AAC-CTG-ACT 5'
RNA strand
5'-AUG-AAU
Amino acid sequence
G
ne
(9)
Macmillan Learning
Label the structural features of the yeast phenylalanine tRNA.
Answer Bank
region that carries the amino acid
at its end
Extra arm
5' end
region that contains the bases
ribothymidine and pseudouridine
region that contains the
base dihydrouridine
region that contains the anticodon,
which base pairs with the mRNA
INSTRUCTION:
= IF BOTH STATEMENT ARE TRUE
= IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE
= IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE
= IF BOTH STATEMENTS ARE FALSE
STAMENT 1: Amino acyl tRNA synthase is the enzyme responsible for joining amino acid together
STAMENT 2: Nucleus is the part of the cell where translation takes place
ANSWER:
STAMENT 1: DNA sequences where RNA polymerase binds initially is called promoter sequences
STAMENT 2: UV light causes adenine to dimerize
ANSWER:
STAMENT 1: Guanosine is the name of the compound formed when guanine is bonded to ribose
STAMENT 2: DNA pairing is the term that refers to the process when two complementary and single stranded DNA combine
ANSWER:
Chapter 6 Solutions
BIOLOGY-TEXT
Ch. 6.1 - Which do you think has more entropy, a NaCl...Ch. 6.1 - Prob. 2CCCh. 6.2 - Prob. 1CCCh. 6.2 - Prob. 2CCCh. 6.2 - Prob. 1CSCh. 6.2 - Prob. 1EQCh. 6.2 - Prob. 2EQCh. 6.2 - Prob. 3EQCh. 6.3 - Prob. 1CSCh. 6.3 - Prob. 2CS
Ch. 6.4 - What are advantages of protein degradation?Ch. 6 - Reactions that release free energy are a....Ch. 6 - Enzymes speed up reactions by a. providing...Ch. 6 - Prob. 3TYCh. 6 - Researchers analyzed a cell extracta mixture of...Ch. 6 - In biological systems, ATP functions by a....Ch. 6 - In a chemical reaction, NADH is converted to NAD+...Ch. 6 - Prob. 7TYCh. 6 - Prob. 8TYCh. 6 - Prob. 9TYCh. 6 - Autophagy provides a way for cells to a. degrade...Ch. 6 - Prob. 1CQCh. 6 - Prob. 2CQCh. 6 - Prob. 3CQCh. 6 - Prob. 1COQCh. 6 - Prob. 2COQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Instructions: Express your own gene! (1) Make up a DNA sequence of at least 18nucleotides and then (2) show the mRNA sequence that will be made via transcription,(3) show the tRNAs that will base pair and deliver the amino acids, and (4) the aminoacid sequence of the resulting protein. You can use the single letter abbreviations forDNA and RNA nucleotides and the three-letter abbreviations for the amino acids.arrow_forwardVISUAL SKILLS A segment in the middle of an mRNA has thesequence 5¿-AGAGAACCGCGA-3¿. Using the codon table, translate thissequence, assuming the first three nucleotides are a codon.arrow_forwardINSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: Heterogenous RNA is a term that refers to mRNA that has not been processed STAMENT 2: If the %A of a bacteria is 20%, the amount of guanine is 30% STAMENT 1: A frameshift mutation involves a change in the reading frame used in the translation of an mRNA STAMENT 2: The genetic code is specific because each codon specifies only for one amino acid STAMENT 1: Binding of RNA primer to the DNA is the first step in the transcription cycle STAMENT 2: Translation refers to the synthesis of proteins using the information contained in mRNAarrow_forward
- 1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You can use the one-letter code for valine (V) and do not have to draw the amino acid structure. Label the tRNA and amino acid binding sites on the enzyme. Explain the function of valine-aminoacyl tRNA synthetase and explain why there are 20 related enzymes in every cell.arrow_forwardExercise 1 The order of a molecule of mRNA is given like following. AAAUGUCAAACGAGGCCGAUCAUUAAACU a- Determine the corresponding non-transcribed strand of DNA based on the above RNA molecule. C b- Name the phenomenon shown in the figures. c- What is the codon of start ? d- Arrange the stages given in the chronological order.arrow_forwardNeed help:, The rRNAs are isolated from the large subunit of a bacterial ribosome and separated by density gradient centrifugation. Draw the resulting density gradient and label the bands observed. Which rRNA is longest?arrow_forward
- topic: translation how is the growing polypeptide released from the ribosomal assembly?arrow_forwardPlease answer fast Explain how you would go about developing new ribozymes capable of targeting new sequences and that can be controlled using effector molecules of your choosing.arrow_forwardINSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: Transfer RNA is the RNA that contains anticodon STAMENT 2: The tail added to an mRNA to protect it from nuclease digestion is polyA tail ANSWER: STAMENT 1: Heterogenous RNA is a term that refers to mRNA that has not been processed STAMENT 2: If the %A of a bacteria is 20%, the amount of guanine is 30% ANSWER: STAMENT 1: A frameshift mutation involves a change in the reading frame used in the translation of an mRNA STAMENT 2: The genetic code is specific because each codon specifies only for one amino acid ANSWER:arrow_forward
- try w1 II. In each of the following DNA sequences, write on your answer sheet the corresponding mRNAtranscript and use the genetic code to determine the resulting amino acid sequence. Note that the givenstrands are in the 3’ to 5’ direction. Start the amino acid sequence with the start codon and end withstop codon.1. TTTTACCATCCCACAATTTA mRNA: _________________________ Amino acids: _____________________ 2. ACTACTTTCAGAGCTATATTCAG mRNA: _________________________ Amino acids: _____________________arrow_forward• separates the two DNA double helix • matches each DNA nucleotide with a complementary RNA nucleotide • joins each RNA nucleotide to the previous nucleotide in the growing mRNA molecule. 11. Why is RNA polymerase a good name for this enzyme? Explain each part of the name: RNA, polymer and ase. To see the process of transcription in action, https://www.bióinteractive.org/classroom-re- 12. Summarize how transcription makes mRN gene, mRNA, sequence, nucleotides, con Transcription atrarrow_forwardC. Deepen (Pagpapalalim ng Kaalaman) Let us do the activity below. (50 mins. with provision for analysis and writing your answers) PERFORMANCE TASK-SAY IT WITH DNA: PROTEIN SYNTHESIS Directions: 1. Build the correct mRNA molecule by transcribing the template DNA strand. 2. Figure out the TRNA triplets (anti-codons) that would fit the mRNA triplets (letter by letter). 3. Translate the MRNA codons and find the correct amino acid using the Codon Wheel on page 1. 4. Write in the amino acid (abbreviation) then, record the one-letter symbol of the corresponding amino acid. If you do this correctly, the symbols should spell out a meaningful message in English. Note. "Stp" = "space" (no equivalent symbol, leave it blank) MRNA DNA -> TRNA T А U G A -> A -> Here is a partially solved message... Decode the rest of the message. TT CTT DNA message code CTT | GGG ACT TAG AGC ATT CCT GCC CTT CGA TGC MRNA CUU AUC UUU GAA UGA AUC TRNA GAA UAG AAA CUU ACU UAG Amino Acid abbr. (based on MRNA) Leu Ile Phe…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license