BIOLOGY-TEXT
5th Edition
ISBN: 9781260169621
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 6.2, Problem 2EQ
Summary Introduction
To determine: The reason why researchers conducted experiments in which they did not add protein subunits and RNA (Ribose
Introduction: RNase P acts as a catalyst during the processing of transfer RNA (Ribose nucleic acid) molecules. RNase P contains two subunits- one is a RNA molecule that possesses 377
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
GTTTTCACTGGCGAGCGTCATCTTCCTACT
1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…
Instructions: Express your own gene! (1) Make up a DNA sequence of at least 18nucleotides and then (2) show the mRNA sequence that will be made via transcription,(3) show the tRNAs that will base pair and deliver the amino acids, and (4) the aminoacid sequence of the resulting protein. You can use the single letter abbreviations forDNA and RNA nucleotides and the three-letter abbreviations for the amino acids.
Q.)
A.)Search in human genome if any examples of mRNA translated from 2 different sites?and give examples?
B.)aminoacyl tRNA synthetase is specialized or not ? And why?
Chapter 6 Solutions
BIOLOGY-TEXT
Ch. 6.1 - Which do you think has more entropy, a NaCl...Ch. 6.1 - Prob. 2CCCh. 6.2 - Prob. 1CCCh. 6.2 - Prob. 2CCCh. 6.2 - Prob. 1CSCh. 6.2 - Prob. 1EQCh. 6.2 - Prob. 2EQCh. 6.2 - Prob. 3EQCh. 6.3 - Prob. 1CSCh. 6.3 - Prob. 2CS
Ch. 6.4 - What are advantages of protein degradation?Ch. 6 - Reactions that release free energy are a....Ch. 6 - Enzymes speed up reactions by a. providing...Ch. 6 - Prob. 3TYCh. 6 - Researchers analyzed a cell extracta mixture of...Ch. 6 - In biological systems, ATP functions by a....Ch. 6 - In a chemical reaction, NADH is converted to NAD+...Ch. 6 - Prob. 7TYCh. 6 - Prob. 8TYCh. 6 - Prob. 9TYCh. 6 - Autophagy provides a way for cells to a. degrade...Ch. 6 - Prob. 1CQCh. 6 - Prob. 2CQCh. 6 - Prob. 3CQCh. 6 - Prob. 1COQCh. 6 - Prob. 2COQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Need help:, The rRNAs are isolated from the large subunit of a bacterial ribosome and separated by density gradient centrifugation. Draw the resulting density gradient and label the bands observed. Which rRNA is longest?arrow_forwardSuppose your supervisor is working on a molecule “X” with UniProtKB accession number P18564. Being a team member in the project, you have been asked to provide the following information with high accuracy? I. Chromosome number: II. Protein size: III. Number of exons: IV. Stop codon: V. Size of the longest exon in nucleotidesarrow_forwardTranscribe an mRNA sequence from this TEMPLATE STRAND of DNA 3' CGTACGTGTATCCCATCC 5' 5' GCAUGCACAUAGGGUAGG 3' 5' GCAUGCACAUAGGGUAGG 3' 3' CGUACGUGUAUCCCAUCC 5' 5' GCATGCACATAGGGTAGG 3' 3' CGTACGUGTATCCCATCC 5'arrow_forward
- Please do answer all the questions. I'll definitely give a like You discovered a halophilic bacterium and want to characterize the mechanism involved in producing mature tRNA molecules from larger tRNA precursors. You isolated a large complex composed of a protein component and an RNA component that is capable of cleaving the larger tRNA precursor. To determine which one of the two components is responsible for catalysis, you perform an in vitro tRNA cleavage assay in the proper buffer conditions, including a low concentration of Mg2+ and 0.5 M bovine serum albumin (BSA). BSA is not specific for this reaction. The table below summarizes the results after performing eight separate reactions. The + symbol indicates the included reaction components. Q. Based on the results obtained, what can you conclude about the composition of the biological catalyst required for the maturation of tRNA? Q. Indicate which reactions helped you make your conclusion. Why? Q. Which reactions allowed you…arrow_forward5'– ATGGCGAGGCGGCAGCTGTTATGGTGA – 3' In the sequence above, suppose that the 20th nucleotide of the template (an T) was mutated to a A. (A) Now, what is the mRNA sequence? (B) What is the amino acid sequence of the translated protein? (C) Would this protein be able to carry out its function?arrow_forwardQ10. Does frame +2 have an ORF in the coding region of this exon? What about frame +1 and frame +3? Q11. Given that 3 of the 64 possible codons are stop codons, what is the chance of having a stop codon at any given position, assuming that the sequence is random?arrow_forward
- 1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You can use the one-letter code for valine (V) and do not have to draw the amino acid structure. Label the tRNA and amino acid binding sites on the enzyme. Explain the function of valine-aminoacyl tRNA synthetase and explain why there are 20 related enzymes in every cell.arrow_forwardExperiment The consequence of a point mutation in a human tRNAMe gene was studied in this experiment. Plasmids carrying either the wild-type tRNA Me transcription unit or the mutant gene were microinjected into Xenopus laevis oocytes together with [a-3 PIGIP. The oocytes were incubated for 5 hours, and then RNA was extracted from whole oocytes, separated nuclei, or cytoplasm. RNA samples were subjected to polyacrylamide gel electrophoresis and autoradiographyarrow_forwardA short RNA molecule was isolated that demonstrated a hyperchromicshift , indicating secondary structure. Itssequence was determined to be5'-AGGCGCCGACUCUACU-3'(a) Propose a two-dimensional model for this molecule.(b) What DNA sequence would give rise to this RNA moleculethrough transcription?(c) If the molecule were a tRNA fragment containing a CGA anticodon,what would the corresponding codon be?(d) If the molecule were an internal part of a message, whatamino acid sequence would result from it following translation?arrow_forward
- discuss using named examples some of the disadvantages of protein engineering using site directed and random mutagenesisarrow_forwardThe lab you joined recently want to investigate the role of uncoupling protein in-vivo models. Your supervisor knew that you have learnt in-vivo model and uncoupling in your BIOTECH 2CB3 course. Based on the information you learnt you have to make a list of organisms that could be used kind to study the mechanism of uncoupling of proteins? What are you are going tp suggest as an ideal model to study the uncoupling proteins in-vivo? only one answer options: newborn mammals, hibernating animals animals acclimated to cold environments animals live in hot weather I and II I and IIIarrow_forwardGive typing answer with explanation and conclusion a) List three eukaryotic gene expression mechanisms that do not occur in prokaryotes. For two of these, give specific examples and the functional outcomes. b) Describe what is meant by the term “RNA silencing”. c) Using diagrams, give two examples of RNA silencing mechanisms and indicate one difference.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY