Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 7, Problem 15P
Diagram a replication fork in bacterial DNA and label the following structures or molecules.
a. DNA pol III
b. helicase
c. RNA primer
d. origin of replication
e. leading strand (label its polarity)
f. DNA pol I
g. topoisomerase
h. SSB protein
i. lagging strand (label its polarity)
j. primase
k. Okazaki fragment
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The following diagrams represent DNA molecules that are undergoing replication. Draw in the strands of newly synthesized DNA and identify (a) the polarity of the newly synthesized strands, (b) the leading and lagging strands, (c) Okazaki fragments, and (d) RNA primers.
During DNA replication, short RNA primers are made by the Primase. Why?
a.
To provide a 3'-OH so DNA polymerase can begin DNA synthesis.
b.
To recruit single stranded binding proteins to the correct location.
c.
To identify the termination sequence for DNA polymerase during DNA synthesis.
d.
To provide a 3'-OH so RNA polymerase can begin DNA synthesis.
e.
To identify the origin of replication to recruit the origin replication complex to the correct genomic location.
Which of the following statements is FALSE regarding the molecular mechanism for DNA polymerases?
A.
The active site contains 2 divalent metal ions
B.
A single stranded DNA template is required
C.
The enzyme can only attach a new deoxynucleotide to the 5’ end of a growing chain
D.
The 3’OH on the deoyxyribose ring attacks a phosphate of a dNTP to produce a new phosophodiester bond
E.
None of the above (all are true statements)
Chapter 7 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
Ch. 7 - What results from the experiments of Frederick...Ch. 7 - 7.2 Explain why Avery, MacLeod, and McCarty’s in...Ch. 7 - 7.3 Hershey and Chase selected the bacteriophage...Ch. 7 - 7.4 Explain how the Hershey and Chase experiment...Ch. 7 - 7.5 One strand of a fragment of duplex DNA has the...Ch. 7 - 7.6 The principles of complementary base pairing...Ch. 7 - For the following fragment of DNA, determine the...Ch. 7 - 7.8 Figures present simplified depictions of...Ch. 7 - 7.9 Consider the sequence -ACGCTACGTC-.
What is...Ch. 7 - DNA polymerase III is the main DNA-synthesizing...
Ch. 7 - Explain how RNA participates in DNA replication.Ch. 7 - A sample of double-stranded DNA is found to...Ch. 7 - Bacterial DNA polymerase I and DNA polymerase III...Ch. 7 - Diagram a replication fork in bacterial DNA and...Ch. 7 - Prob. 16PCh. 7 - Which of the following equalities is not true for...Ch. 7 - List the order in which the following proteins and...Ch. 7 - Two viral genomes are sequenced, and the following...Ch. 7 - Matthew Meselson and Franklin Stahl demonstrated...Ch. 7 - Raymond Rodriguez and colleagues demonstrated...Ch. 7 - 7.22 Joel Huberman and Arthur Riggs used pulse...Ch. 7 - 7.23 Why do the genomes of eukaryotes, such as...Ch. 7 - Bloom syndrome (OMIM 210900) is an autosomal...Ch. 7 - 7.25 How does rolling circle replication (see...Ch. 7 - Telomeres are found at the ends of eukaryotic...Ch. 7 - A family consisting of a mother (I-1), a father...Ch. 7 - In a dideoxy DNA sequencing experiment, four...Ch. 7 - Prob. 29PCh. 7 - Using an illustration style and labeling similar...Ch. 7 - A PCR reaction begins with one double-stranded...Ch. 7 - Prob. 32PCh. 7 - Three independently assorting VNTR markers are...Ch. 7 - 7.34 A sufficient amount of a small DNA fragment...Ch. 7 - Prob. 35P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- DNA Polymerase holoenzymes used for DNA replication recognizes A. double-stranded sequences as starting points B. methylated lipids as start points C. acetylated lipids as start points D. single stranded sequences as starting pointsarrow_forwardThe following diagram represents a DNA molecule that is undergoing replication. Draw in the strands of newly synthesized DNA and identify (a) the polarity of the newly synthesized strands, (b) the leading and lagging strands, (c) Okazaki fragments, and (d) RNA primers.arrow_forwardConsider the following segment of DNA, which is part ofa much longer molecule constituting a chromosome:5′.…ATTCGTACGATCGACTGACTGACAGTC….3′3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′If the DNA polymerase starts replicating this segmentfrom the right,a. which will be the template for the leading strand?b. Draw the molecule when the DNA polymerase ishalfway along this segment.c. Draw the two complete daughter molecules.d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual modeof replication?arrow_forward
- The problem of replicating the lagging strand—that is, adding bases in the 3’ to 5’ direction—is solved by DNA through the use of (a) base pairing (b) replication forks (c) helicase (d) Okazaki fragments (e) topoisomerasearrow_forwardWhich of the following statements is not true? Explain why. A. A DNA strand can serve as a template strand on many occasions. B. Following semiconservative DNA replication, one strand is a newly made daughter strand and the other strand is a parental strand. C. A DNA double helix may contain two strands of DNA that were made at the same time. D. A DNA double helix obeys the AT/GC rule. E. A DNA double helix could contain one strand that is 10 generations older than its complementary strand.arrow_forwardWhat is the basis for the difference in how the leading andlagging strands of DNA molecules are synthesized?(A) The origins of replication occur only at the 5′ end.(B) Helicases and single-strand binding proteins work at the5′ end.(C) DNA polymerase can join new nucleotides only to the3′ end of a pre-existing strand, and the strands areantiparallel.(D) DNA ligase works only in the 3′ S 5′ directionarrow_forward
- What is the difference between the leading strand and the lagging strand in DNA replication? a There are different DNA polymerases involved in elongation of the leading strand and the lagging strand. b The leading strand is synthesized continuously in the 5' → 3' direction, while the lagging strand is synthesized discontinuously in the 5' → 3' direction. c The leading strand requires an RNA primer, whereas the lagging strand does not. d The leading strand is synthesized in the 3' → 5' direction in a discontinuous fashion, while the lagging strand is synthesized in the 5' → 3' direction in a continuous fashion.arrow_forwardIt is essential that RNA primers at the ends of Okazakifragments be removed and replaced by DNA becauseotherwise which of the following events would result?a. The RNA would interfere with topoisomerasefunction.b. The RNA would be more likely to contain errorsbecause primase lacks a proofreading function.c. The β-clamp of the DNA pol II dimer would releasethe DNA and replication would stop.d. The RNA primers would be likely to hydrogen bondto each other, forming complex structures that mightinterfere with the proper formation of the DNA helixarrow_forwardWhat is the major role of DNA polymerase in the DNA replication? a. Attached RNA primers to initiate the addition of complementary nucleotide sequence at the 5’ to 3’direction b. Adds up new complementary nucleotide sequence at the 3’ to 5’ direction of the DNA template. c. Unwinds the double helix by breaking the bonds at the 3’ to 5’ polymerization activity. d.It transiently cuts each strand to prevent supercoil at the 5’ to 3’ polymerization activity complementary to the RNA strandarrow_forward
- Which of the following do you think would be true of the sites of the origin of replication (where DNA strands first begin to separate?) Hint: think about which would be the easiest to pull apart. (a) they would be rich in purines (b) they would be rich in A and T sequences (c) they would be rich in pyrimidines (d) they would be rich in G and C sequences (e) they would be rich in A sequencesarrow_forwardThe work of Meselson and Stahl: A. Showed that DNA replication is semiconservative, which means that the parental double helix is conserved B. Combined the use of 3H-thymidine with centrifugation to distinguish DNA molecules based on size C. Showed that the DNA, after one round of replication, was of intermediate density D. All of the Above E. None are correctarrow_forwardIn order for DNA molecules to undergo recombination, ____. a. their strands must separate as in replication b. they must be from the same species c. one of the two DNA strands must be degraded d. they must be cut and spliced at specific nucleotide sequences e. they must first be transcribedarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY