Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 7, Problem 8P
Figures
a. What kind of bond joins the C to the G within a single strand?
b. What kind of bonds join the C in one strand to the G in the complementary strand?
c. How many phosphodiester bonds are present in this DNA duplex?
d. How many hydrogen bonds are present in this DNA duplex?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC
Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC
Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence:
Name and explain two different ways in which DNA can be damaged.
Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?
A student has drawn an enlarged portion of a DNA “ladder” model to show two of the nucleotides in greater detail (in the same orientation as they would occur in the ladder model). Which two nucleotides did the student draw?
Which is a difference between B-DNA and A-DNA?
A. For polynucleotide strands containing the same number of nucleotides, the B-DNA strand will be shorter from end-to-end than the corresponding A-DNA.
B. Both are helical, but B-DNA is right-handed and A-DNA is left-handed.
C. The sugar in A-DNA is more oxidized than that in B-DNA
D. Helical structures in RNA predominantly adopt the B-DNA conformation.
E. None of the above.
The tetranucleotide AGTC (in DNA) has a free hydroxyl group on ____.
A. A
B. G, T, and C
C. C
D. A, G, T, and C
Chapter 7 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
Ch. 7 - What results from the experiments of Frederick...Ch. 7 - 7.2 Explain why Avery, MacLeod, and McCarty’s in...Ch. 7 - 7.3 Hershey and Chase selected the bacteriophage...Ch. 7 - 7.4 Explain how the Hershey and Chase experiment...Ch. 7 - 7.5 One strand of a fragment of duplex DNA has the...Ch. 7 - 7.6 The principles of complementary base pairing...Ch. 7 - For the following fragment of DNA, determine the...Ch. 7 - 7.8 Figures present simplified depictions of...Ch. 7 - 7.9 Consider the sequence -ACGCTACGTC-.
What is...Ch. 7 - DNA polymerase III is the main DNA-synthesizing...
Ch. 7 - Explain how RNA participates in DNA replication.Ch. 7 - A sample of double-stranded DNA is found to...Ch. 7 - Bacterial DNA polymerase I and DNA polymerase III...Ch. 7 - Diagram a replication fork in bacterial DNA and...Ch. 7 - Prob. 16PCh. 7 - Which of the following equalities is not true for...Ch. 7 - List the order in which the following proteins and...Ch. 7 - Two viral genomes are sequenced, and the following...Ch. 7 - Matthew Meselson and Franklin Stahl demonstrated...Ch. 7 - Raymond Rodriguez and colleagues demonstrated...Ch. 7 - 7.22 Joel Huberman and Arthur Riggs used pulse...Ch. 7 - 7.23 Why do the genomes of eukaryotes, such as...Ch. 7 - Bloom syndrome (OMIM 210900) is an autosomal...Ch. 7 - 7.25 How does rolling circle replication (see...Ch. 7 - Telomeres are found at the ends of eukaryotic...Ch. 7 - A family consisting of a mother (I-1), a father...Ch. 7 - In a dideoxy DNA sequencing experiment, four...Ch. 7 - Prob. 29PCh. 7 - Using an illustration style and labeling similar...Ch. 7 - A PCR reaction begins with one double-stranded...Ch. 7 - Prob. 32PCh. 7 - Three independently assorting VNTR markers are...Ch. 7 - 7.34 A sufficient amount of a small DNA fragment...Ch. 7 - Prob. 35P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What describes or designates the 3' end of a DNA strand? a. an available hydroxyl group on the 5th carbon of a deoxyribose of a terminal nucleotide b. an available phosphate group on the 3rd carbon of a deoxyribose of a terminal nucleotide c. an available hydroxyl group on the 3rd carbon of a deoxyribose of a terminal nucleotide d. an available hydroxyl group on the 2nd carbon of a deoxyribose of a terminal nucleotidearrow_forwardWhat defines one end of a DNA molecule as the 5’ end? a. What defines the other end at the 3’ end? b. When two strands of DNA are paired together to form a functional molecule, what is interesting to note about their 5’ and 3’ ends?arrow_forwardEnzymes that break down DNA catalyze the hydrolysis of the covalent bonds that join nucleotides together. What would happen to DNA molecules treated with these enzymes? Group of answer choices A. All bases would be separated from the deoxyribose sugars B. The purines would be separated from the deoxyribose sugars C. The phosphodiester linkages between deoxyribose sugars would be broken D. The two strands of the double helix would separate E. The pyrimidines would be separated from the deoxyribose sugarsarrow_forward
- Draw a 4-N base strand of DNA with all four N-base sequences representedarrow_forwardDraw the structure of deoxyribose and number the carbon atoms.Describe the numbering of the carbon atoms in deoxyribose withregard to the directionality of a DNA strand. In a DNA doublehelix, what does the term antiparallel mean?arrow_forwardGiven this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it tend to cause a deletion to form, or an inversion? Diagram how it (either the deletion or inversion) will happen. xxxxxxxcatatgctttcag (another five hundred or so letters) catatgctttcagxxxxxxxxx Ditto, using this sequence xxxxxxxxcatatgctttcag (another five hundred or so letters) gactttcgtatacxxxxxxxxxxxarrow_forward
- Does the addition of a histidine tag affect DNA polymerase activity and or processivity? Give a detailed explanation.arrow_forwardBelow is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…arrow_forward. In analyzing the number of different bases in a DNAsample, which result would be consistent with thebase-pairing rules?(A) A = G(B) A + G = C + T(C) A + T = G + C(D) A = Carrow_forward
- Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already been denatured, and the temperature has been decreased to an appropriate annealing temperature. Show where the two primers would anneal to the strands, then indicate the direction of extension on each new strand with an arrow. 5’--T C A G G A C G T A A G C T T G C A T A T C T C G A T G C T A A A T C A T—3’ 3’--A G T C C T G C A T T C G A A C G T A T A G A G C T A C G A T T T A G T A—5’ Primer #1: 3’ A C G A T T T 5’ Primer #2: 5’ G G A C G T A 3’arrow_forwardUsing the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "A"? to separate the double helix into two to piece together the Okazaki segments to copy the new DNA strand to the old strand by complementary base pairing Using the figure below, what is molecule "G" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "G"? to separate the double helix into two to piecearrow_forwardUsing the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "A"? to separate the double helix into two to piece together the Okazaki segments to copy the new DNA strand to the old strand by complementary base pairing Using the figure below, what is molecule "G" (type a 1, 2 or 3 in the blank) nuclease ligase DNA polymerase What is the function of molecule "G"? to separate the double helix into two to piece together the Okazaki segments to copy the new DNA strand to the old strand by complementary base pairing Which of the following statements best describes why one of the daughter strands is synthesized in pieces? the enzymes that synthesize DNA are slower that the enzymes that unwind the double helix and this produces 'lagging time' the enzymes that synthesize DNA can only do so in a 5' --->3' direction this figure illustrates a eukaryotic cell since prokaryotic cells do not synthesize DNA…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license