Concept explainers
Introduction:
“DNA (deoxyribonucleic acid)” is made up of nitrogenous bases like Adenine, thymine, guanine; cytosine. This nitrogenous base helps in
The lagging strand is one of the two strands of DNA, it is found at the replication fork. Other strand is called leading strand. Okazaki fragments are the short, newly synthesized DNA fragments that are formed on the lagging template strand during DNA replication.
Want to see the full answer?
Check out a sample textbook solutionChapter 7 Solutions
Microbiology With Diseases By Taxonomy (6th Edition)
- Which type of cells were used to extract the DNA that was sequenced? a. red blood cells c. white blood cells b. intestinal epithelium d. cheek swab What type of mutation caused Nicholas’s disease? a. frameshift c. nonsense b. missense d. insertionarrow_forwardThe original DNA base sequence is 5’-AGCGTTACCGT-3’; a mutation in the DNA strand results in the base sequence 5’-AGGCGTTACCGT-3’. What can you conclude about the mutation? A. It is a frameshift mutation. B. It is a silent mutation. C. It is a deleterious mutation. D. It may result in a single amino acid change in the protein being coded for by this base sequence.arrow_forwardSuccessful bacterial DNA replication does NOT … please explain the answer choice a.ligate DNA nicks b.use a bidirectional fork c.prime new synthesis using DNA primers d.have SSB (single strand binding protein) stabilize single stranded DNAarrow_forward
- Following transcription, the RNA has a complementary sequence of which of the following?Question 9 options: A) regulatory sequences B) termination sequences in the coding strand of DNA C) the template strand of DNA D) none of the answers are correctarrow_forwarda mutation in dna that adds +1 ot -1 nucleotide or +2 or -2 nucleotides is called a______? (choose one answer only) A. frameshift mutation B. silent mutation C. nonsense mutation D. missense mutationarrow_forwardGiven the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedarrow_forward
- DNA polymerases ____. a. add new nucleotides to a strand b. repair DNA c. assemble new strands in both direction d. seal gaps in the sugar-phosphate backbone e. catalyze carbon bondingarrow_forwardIn Eukaryotes, DNA is a long molecule inside a tiny nucleus. a. How can this long chain fit in such space? b. How does it affect gene expression?arrow_forwardIn DNA replication, the role of topoisomerase is to Question 11 options: a) "unzip" the double stranded DNA in front of DNA polymerase. b) maintain the single stranded DNA. c) supercoil the DNA after the replication fork has passed. d) relieve supercoil tension in the DNA in front of the replication fork.arrow_forward
- Spontaneous mutations can arise from a. all answers are correct b. DNA polymerase inserts an incorrect nucleotide c. a loop occurs during replication d. a base gets damagedarrow_forwardhow does the E.coli ribosome find the RNA to be translated? A. the sigma factor B. the shine- Dalgarno sequence C. the kozak sequence D. thee 5'caparrow_forwardTranscription is similar to DNA replication because both processes_______ . a. use the same enzyme b. copy both strands c. require the same nucleotides d. proceed in the 5′ to 3′ directionarrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College