Microbiology With Diseases By Taxonomy (6th Edition)
Microbiology With Diseases By Taxonomy (6th Edition)
6th Edition
ISBN: 9780134832302
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 7, Problem 13CT
Summary Introduction

To explain:

The reason for the fact that the accuracy of RNA transcription is not critical to the accuracy of DNA replication.

Concept introduction:

Gene is defined as the basic unit of heredity. It is basically a sequence of nucleotides in the DNA (deoxyribonucleic acid) that codes for functional proteins. In the expression of genes, DNA is first transcribed into RNA (ribonucleic acid) and then, this RNA is translated into proteins. The proteins are responsible for the proper functioning of the cell.

Blurred answer
Students have asked these similar questions
Which of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction? 5′ ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3′ 3′ TGCCTGACATGGCGACTTCAGTACCTGCGAGCT 5′ ⎯⎯⎯⎯→ Direction of DNA unwinding What would be the resulting RNA sequence (written 5′→3′ )?
List two possible reasons why a mistake during the process of replication is more of a catastrophe than a mistake in the process of transcription.  What mechanisms help to ensure the fidelity of the process of replication?
DNA polymerases are capable of editing and error correction, meaning it is able to edit and correct single base error so that the gene is not affected. However, RNA polymerase has a limited capacity for error correction. Given that a single base error in either replication or transcription can lead to error in protein synthesis, suggest a brief explanation for this difference in the capability of error correction between DNA polymerase and RNA polymerase.

Chapter 7 Solutions

Microbiology With Diseases By Taxonomy (6th Edition)

Ch. 7 - Prob. 6MCCh. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - Prob. 9MCCh. 7 - Prob. 10MCCh. 7 - Which of the following is not a mechanism of...Ch. 7 - Prob. 12MCCh. 7 - Prob. 13MCCh. 7 - Which of the following are called jumping genes?...Ch. 7 - Prob. 15MCCh. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Prob. 24MCCh. 7 - The trp operon is repressible. This means it is...Ch. 7 - The three steps in RNA transcription are...Ch. 7 - Prob. 2FIBCh. 7 - Prob. 3FIBCh. 7 - Prob. 4FIBCh. 7 - An operon consists of ____________,...Ch. 7 - Prob. 6FIBCh. 7 - A daughter DNA molecule is composed of one...Ch. 7 - Prob. 8FIBCh. 7 - Prob. 9FIBCh. 7 - ____________ is a recombination event that occurs...Ch. 7 - Prob. 11FIBCh. 7 - Prob. 12FIBCh. 7 - Prob. 1SACh. 7 - Prob. 2SACh. 7 - Prob. 3SACh. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Prob. 5SACh. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Prob. 8SACh. 7 - Describe how DNA is packaged in both prokaryotes...Ch. 7 - Prob. 10SACh. 7 - Prob. 11SACh. 7 - Prob. 12SACh. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - Prob. 3VICh. 7 - If molecules of mRNA have the following nucleotide...Ch. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Prob. 3CTCh. 7 - Prob. 4CTCh. 7 - Prob. 5CTCh. 7 - Suppose that the E. coli gene for the lac operon...Ch. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Prob. 9CTCh. 7 - How can knowledge of nucleotide analogs be useful...Ch. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Prob. 12CTCh. 7 - Prob. 13CTCh. 7 - Prob. 14CTCh. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Prob. 17CT
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License