Microbiology With Diseases By Taxonomy (6th Edition)
6th Edition
ISBN: 9780134832302
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 7, Problem 1CT
If molecules of mRNA have the following
- a. AUGGGGAUACGCUACCCC
- b. CCGUACAUGCUAAUCCCU
- c. CCGAUGUMCCUCGAUCC
- d. AUGCGGUCAGCCCCGUGA
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A single template strand of a DNA molecule is represented by
3’atgtaccatgcgcaaatttaaaggccc5’.
a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications?
b) Write the amino acid sequence of your mature mRNA.
c) List the molecules involved in translation and briefly describe their function.
3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’
If the RNA synthesized above is a functional mRNA and all the nucleotides belong to an exon,
a. how many codons are present in this mRNA?
b. how many codons actually code for a protein in this mRNA?
c. what stop codon is present in this mRNA?
Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'
Chapter 7 Solutions
Microbiology With Diseases By Taxonomy (6th Edition)
Ch. 7 - DNA replication requires a large amount of energy,...Ch. 7 - In bacteria, polypeptide translation can begin...Ch. 7 - Prob. 3TMWCh. 7 - Prob. 4TMWCh. 7 - Clinical Case Study Deadly Horizontal Gene...Ch. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - Prob. 3MCCh. 7 - Prob. 4MCCh. 7 - Prob. 5MC
Ch. 7 - Prob. 6MCCh. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - Prob. 9MCCh. 7 - Prob. 10MCCh. 7 - Which of the following is not a mechanism of...Ch. 7 - Prob. 12MCCh. 7 - Prob. 13MCCh. 7 - Which of the following are called jumping genes?...Ch. 7 - Prob. 15MCCh. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Prob. 24MCCh. 7 - The trp operon is repressible. This means it is...Ch. 7 - The three steps in RNA transcription are...Ch. 7 - Prob. 2FIBCh. 7 - Prob. 3FIBCh. 7 - Prob. 4FIBCh. 7 - An operon consists of ____________,...Ch. 7 - Prob. 6FIBCh. 7 - A daughter DNA molecule is composed of one...Ch. 7 - Prob. 8FIBCh. 7 - Prob. 9FIBCh. 7 - ____________ is a recombination event that occurs...Ch. 7 - Prob. 11FIBCh. 7 - Prob. 12FIBCh. 7 - Prob. 1SACh. 7 - Prob. 2SACh. 7 - Prob. 3SACh. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Prob. 5SACh. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Prob. 8SACh. 7 - Describe how DNA is packaged in both prokaryotes...Ch. 7 - Prob. 10SACh. 7 - Prob. 11SACh. 7 - Prob. 12SACh. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - Prob. 3VICh. 7 - If molecules of mRNA have the following nucleotide...Ch. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Prob. 3CTCh. 7 - Prob. 4CTCh. 7 - Prob. 5CTCh. 7 - Suppose that the E. coli gene for the lac operon...Ch. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Prob. 9CTCh. 7 - How can knowledge of nucleotide analogs be useful...Ch. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Prob. 12CTCh. 7 - Prob. 13CTCh. 7 - Prob. 14CTCh. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Prob. 17CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)arrow_forwardBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon,a. how many codons are present in this mRNA?b. how many codons actually code for proteins in this mRNA?c. what stop codon is present in this mRNA?arrow_forwardA particular triplet of bases in the anticodon strand of the tRNA is 5' - AGU - 3'. A. The corresponding codon for the mRNA is _________ (write 5’ --> 3). B. If this codon is translated, the codon specifies the addition of which amino acid? _______________________arrow_forward
- The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? a. complementarity b. nonsense codons c. universality d. degeneracyarrow_forwardTranslation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence TTCGACCCT B) an mRNA strand with the sequence TTCGACCCT C) a sequence of three amino acids linked by peptide bonds D) an mRNA strand with the sequence UUGCACCCUarrow_forwardOnce translated into proteins: (a) How many nucleotides are there? (b) How many codons are there? (c) How many amino acids?arrow_forward
- The codon UUU in an mRNA molecule which results in phenylalanine being inserted as the protein is made. Which will be a characteristic of this codon? a. The tRNA molecule that binds to the UUU codon must have an AAA anticodon. Nde ba e2? b. UUU could code for both phenylalanine and alanine during translation. c. The aminoacyl-tRNA synthetase for phenylalanine binds only the UUU codon. d. UUU is probably only one of several codons that code for phenylalanine.arrow_forwardAn mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that will be translated from this mRNA.arrow_forwardGiven the following non-coding strand of DNA nucleotides:G T T C C C T T T G G A A C C T G G Write the nucleotide sequence of the coding strand of DNA:b. Write the nucleotide sequence of mRNA resulting from transcription:c. Using the genetic code, write the amino acid sequence translated:arrow_forward
- Write a mRNA sequence for the below nucleotide sequences ATTACACACAGCGCGTATACGCGCGCGGGCTATAarrow_forwardTemplate strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code tablearrow_forwardA single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using the same strand above as a template, write the pre-mRNA transcript. b) List the molecules that must be present for DNA to be transcribed. Briefly describe their function. c) What are three modifications that happen to pre-mRNA before it becomes mature mRNAarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license