Concept explainers
(1)
To define:
The health-care associated infection.
Case summary:
In the given summary, an 85-year-old lady was hospitalized after she broke her hip by falling in the bathroom. She had a series of complications and her treatment is necessitated by a urinary catheter, a feeding tube, and an intensive antibiotic therapy. She acquired a life-threatening urinary tract infection along with the multi-drug resistant Enterococcus faecium. The patient lost her life even though she was treated with antimicrobial drugs including penicillin, metronidazole, ciprofloxacin, erythromycin, and vancomycin.
(2)
To determine:
What is the likely source of the patient’s infection.
Case summary:
In the given summary, an 85-year-old lady was hospitalized after she broke her hip by falling in the bathroom. She had a series of complications and her treatment is necessitated by a urinary catheter, a feeding tube, and an intensive antibiotic therapy. She acquired a life-threatening urinary tract infection along with the multi-drug resistant Enterococcus faecium. The patient lost her life even though she was treated with antimicrobial drugs including penicillin, metronidazole, ciprofloxacin, erythromycin, and vancomycin.
(3)
To determine:
List three ways through which E. faecium acquires drug resistant genes.
Case summary:
In the given summary, an 85-year-old lady was hospitalized after she broke her hip by falling in the bathroom. She had a series of complications and her treatment is necessitated by a urinary catheter, a feeding tube, and an intensive antibiotic therapy. She acquired a life-threatening urinary tract infection along with the multi-drug resistant Enterococcus faecium. The patient lost her life even though she was treated with antimicrobial drugs including penicillin, metronidazole, ciprofloxacin, erythromycin, and vancomycin.
(4)
To determine:
How the hospital personnel could prevent the spreading of resistant E. faecium all over the hospital.
Case summary:
In the given summary, an 85-year-old lady was hospitalized after she broke her hip by falling in the bathroom. She had a series of complications and her treatment is necessitated by a urinary catheter, a feeding tube, and an intensive antibiotic therapy. She acquired a life-threatening urinary tract infection along with the multi-drug resistant Enterococcus faecium. The patient lost her life even though she was treated with antimicrobial drugs including penicillin, metronidazole, ciprofloxacin, erythromycin, and vancomycin.
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 7 Solutions
EBK MICROBIOLOGY:W/DISEASES BY BODY...-
- Materials In order to determine the genetic material of a T2 phage, Alfred Hershey and Martha Chase conducted experiments using T2 phages that infected bacteria. In one treatment, they grew phages with radioactive sulfur. In another treatment, they grew phages with radioactive phosphorous. They allowed both types of phages to infect bacterial cells. After infection, they found that only bacteria infected with phages grown with radioactive phosphorous showed any radioactivity. Why did they use radioactive sulfur and phosphorous for this Updates Grades Members O Conferences DBQ Online experiment? * Newsela ormation O Sulfur is part of the DNA molecule but not part of a protein molecule. Biology Periods 1 and 2 Sulfur and phosphorous are some of the most reactive molecules and are easily ding periods school MP1, Highschool Highschool MP3, school MP4 traced. Sulfur and phosphorous are able to survive the centrifuge, a crucial component of the experiment. ion Phosphorous is part of the DNA…arrow_forwardClone number in this case is number 196 as shown in the images. What is the exact length of the segment of human DNA that has been inserted into the plasmid? *report the entire length of the insert, not just the sequences matching the ends and labels of wells isn't needed for answer*arrow_forwardCloning vectors are not just limited to bacterial plasmids. Bacteriophages and M13 phage vectors are also commonly utilized in the cloning process. State any five (5) key criteria to be an effective cloning vector.arrow_forward
- Genome for C. diphtheriae have about 2,500,000 nucleotides, 87% of them are coding. This ingle circular chromosome contains 2,389 genes from which 2,272 proteins are coded. It does not contain any plasmids. The genome contains Pathogenicity Islands (PAIs), which C. diphtheriae has 13. What is a PAI and what are their characteristics?arrow_forwardTo test patients for COVID19, lab workers will first convert all the RNA molecules extracted from a nasal swab to a double-stranded DNA copy (dsDNA). If the virus is present, its genomic sequence should be in some of the new dsDNA molecules. Part 1) A region of COVID genomic DNA sequence is shown below. Following convention, only the top strand is shown. Copy/paste the sequence into the text box and create the second strand. Be sure to label its ends. (You may need to reduce the font size so that it doesn't wrap around) AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTC Part 2) To test for the presence of COVID DNA sequence, lab workers use single-stranded DNA oligonucleotides as probes (short pieces of DNA that do not have a partner strand). If the two strands of DNA that you drew were separated from each other, where would the shorter DNA strand shown below be able to form continuous base pairs? Highlight that region in your dsDNA model. TGTAGCACGATTGCAGCATTG Note: If you…arrow_forwardTRUE OR FALSE. a) The Sanger method of DNA sequencing follows the principle of complementarity just like in the replication process. b) Supercoiling whether positive or negative, can be experienced in the replication or transcription process.arrow_forward
- For each of the following scenarios, indicate YES (it is cloning) or NO (it is not cloning). 6. ___________ Sperm taken from a male goat is combined with a female's egg in a petri dish. The resulting embryo is implanted into the female's uterus to develop 7. ___________ A sheep embryo, composed of 16 cells, is removed from the mother's uterus and separated into individual cells. Each cell is allowed to multiply, creating 16 separate embryos, which are then implanted in different female sheep to develop to maturity. 8. ___________ A cow with many desirable traits is stimulated with hormones to produce a number of egg cells. Each of these eggs is fertilized and implanted into a surrogate mother. 9. ___________ Cell nuclei from a recently deceased dog are placed into enucleated egg cells from another female dog. These egg cells are then placed into the uterus of an additional female surrogate dog, where it grows into a puppy.arrow_forwardBacteriophage lambda is as one of the routinely used molecular cloning vectors, which alsoserved as a model system for the study of bacteriophage morphogenesis, DNA replication, andgene regulation.a) With the aid of a diagram, generally narrate how a foreign gene can be inserted into alambda insertion vector and subsequently infect an Escherichia coli cell.b) You are cloning a 7.5 kb gene into a lambda gt10 vector, utilizing a restriction site whichspecifically present in the vector. State the restriction site that you can use for this purposeand suggest a screening procedure to indicate successful integration of the gene into thehost genome.arrow_forwardE. coli cells are simultaneously infected with two strains of phage λ. One strain has a mutant host range, is temperature sensitive, and produces clear plaques (genotype h st c); another strain carries the wildtype alleles (genotype h+ st+ c+). Progeny phages are collected from the lysed cells and are plated on bacteria. The following numbers of different progeny phages are obtained: Progeny phage genotype Number of plaques h+ c+ st+ 321 h c st 338 h+ c st 26 h c+ st+ 30 h+ c st+ 106 h c+ st 110 h+ c+ st 5 h c st+ 6 a. Determine the order of the three genes on the phage chromosome. b. Determine the map distances between the genes. c. Determine the coefficient of coincidence and the interferencearrow_forward
- In a genetics lab, Kim and Maria infected a samplefrom an E. coli culture with a particular virulent bacteriophage. They noticed that most of the cells werelysed, but a few survived. The survival rate in theirsample was about 1 × 10−4. Kim was sure the bacteriophage induced the resistance in the cells, whileMaria thought that resistant mutants probably alreadyexisted in the sample of cells they used. Earlier, for adifferent experiment, they had spread a dilute suspension of E. coli onto solid medium in a large petri dish,and, after seeing that about 105colonies were growingup, they had replica-plated that plate onto three otherplates. Kim and Maria decide to use these plates totest their theories. They pipette a suspension of thebacteriophage onto each of the three replica plates.What should they see if Kim is right? What shouldthey see if Maria is right?arrow_forwardAnimals can also be genetically modified besides bacteria. As to date, transgenic cows, goats and pigs have been created in the lab. Elaborate on TWO (2) most widely used transfection methods to genetically modify an animal cell.arrow_forwardPlease make this as SIMPLE as possible Question: regarding to horizontal gene transfer please only discuss what cells are still alive or dead between transformation, trasnduction, and conjugation Be specific when discussing the donor versus recipient cell, and if the donor and recipient cells are still alive after each horizontal gene transfer event is completearrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)